ID: 970926068

View in Genome Browser
Species Human (GRCh38)
Location 4:21453787-21453809
Sequence ATGTGCTAGCTGAAAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970926068_970926070 -8 Left 970926068 4:21453787-21453809 CCATCTCCTTTCAGCTAGCACAT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 970926070 4:21453802-21453824 TAGCACATTTTCTCTTTGCCAGG 0: 1
1: 0
2: 1
3: 25
4: 317
970926068_970926071 -7 Left 970926068 4:21453787-21453809 CCATCTCCTTTCAGCTAGCACAT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 970926071 4:21453803-21453825 AGCACATTTTCTCTTTGCCAGGG 0: 1
1: 0
2: 2
3: 39
4: 294
970926068_970926073 12 Left 970926068 4:21453787-21453809 CCATCTCCTTTCAGCTAGCACAT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 970926073 4:21453822-21453844 AGGGAAGCAGTGCTGCGTGATGG 0: 1
1: 0
2: 2
3: 24
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970926068 Original CRISPR ATGTGCTAGCTGAAAGGAGA TGG (reversed) Intronic
900226010 1:1534016-1534038 ATGTGCTGGCTGAAGGCGGAAGG + Exonic
900844521 1:5086080-5086102 AGGTGCCAGCTGAGAGGTGAGGG - Intergenic
901324104 1:8356732-8356754 TTGTGCCAGCAGAGAGGAGAGGG - Intronic
909031677 1:70548748-70548770 TTGTGCTTCCTGCAAGGAGAGGG + Intergenic
910207371 1:84761735-84761757 ATGTCCTAGCTGGAAGCAAATGG - Intergenic
910506857 1:87959334-87959356 ATGTGCTGGCTGAGAGGCTAGGG + Intergenic
911064287 1:93773835-93773857 ATGAGCTGGCTAGAAGGAGAAGG - Intronic
911330952 1:96525225-96525247 ATGTTTAAGCTGAAAGGTGAAGG + Intergenic
911485027 1:98494699-98494721 ATATGCTAGTTGAAATTAGATGG + Intergenic
911496933 1:98643225-98643247 AGGTGCTTGCTGAAAGGCAAAGG + Intergenic
911695986 1:100890959-100890981 AGGTGCTTGCTGAAAGCAAAGGG + Intronic
911980675 1:104561382-104561404 AGGTGCTTGCTGAAAGCAAAGGG + Intergenic
913598966 1:120404845-120404867 GGGTGGGAGCTGAAAGGAGAAGG - Intergenic
914088411 1:144474775-144474797 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914310201 1:146459435-146459457 GAGTGGGAGCTGAAAGGAGAAGG - Intergenic
914379637 1:147104750-147104772 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914591909 1:149113704-149113726 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
916012388 1:160717958-160717980 ATGTGCTAGCAGACAGGGAAAGG - Intergenic
916244939 1:162677837-162677859 ATGTGAAAGCTGAAAGCTGAGGG - Intronic
916974983 1:170066611-170066633 ATCTGCTAACTGAAAAGAGAGGG + Intronic
918345863 1:183606619-183606641 AGGTGCTGGCTGAAGGGAGCTGG + Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
919319645 1:196019187-196019209 ATGTGCAAGCAGGAATGAGAAGG + Intergenic
920906016 1:210169037-210169059 ATGTGCAAGCTAGAGGGAGAAGG - Intronic
921145213 1:212349175-212349197 ATATGCTAGCTAAAAGGTAAGGG - Exonic
922108171 1:222530569-222530591 ATCGGCTAGCTGAGAGGAAAGGG + Intronic
923471648 1:234296151-234296173 ATGTGCTTTCTTAAAGCAGAAGG + Intronic
924252535 1:242147281-242147303 TTATGCTAGCTGAAAGAAGCAGG - Intronic
924459634 1:244247602-244247624 AAGTGCTAGCTCACAGGAGAGGG + Intergenic
1063470482 10:6280640-6280662 ATCTGCTTGCTGAATAGAGAGGG + Intergenic
1063740759 10:8816518-8816540 TTGTGCCTGCTGTAAGGAGAAGG - Intergenic
1063970818 10:11380142-11380164 ATGGGCTGCCTGAAAGCAGAGGG + Intergenic
1064893383 10:20206388-20206410 ATCTGCTGGGTGGAAGGAGAAGG + Intronic
1067535204 10:47104416-47104438 CAGTGCTAGATGAAGGGAGAGGG + Intergenic
1067754084 10:48991741-48991763 AGGTGCTTGCTGAAGGCAGAGGG - Intergenic
1068017477 10:51535608-51535630 ATGTAGTAGCTTAAATGAGAAGG + Intronic
1069655523 10:70085103-70085125 ATGTGGTGACTGGAAGGAGATGG + Intronic
1070546409 10:77456317-77456339 CTGTGCAAGCTGACATGAGAAGG - Intronic
1072238513 10:93473754-93473776 TTGTACTATCTGAAAGGATAGGG - Intronic
1073204383 10:101761247-101761269 ATGTGGTGGCTGCAAGGGGATGG - Intergenic
1073296905 10:102445874-102445896 ATGTGCTTGCTCACAGGACAAGG + Intergenic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1074016011 10:109534726-109534748 AATTGCTAGCAGAAAGAAGATGG + Intergenic
1074319851 10:112392044-112392066 ATGTGCCATCTGGAAGAAGAGGG + Intronic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1075366854 10:121897995-121898017 ATGTGTAAGCTAAAAAGAGAGGG - Intronic
1075475285 10:122728814-122728836 AGGTGCCAGGTGACAGGAGAGGG + Intergenic
1078468764 11:11570371-11570393 GTGGGCTAGCTGTAAGGAGAGGG - Intronic
1078896126 11:15598877-15598899 ATATGGTAGCTGGATGGAGAAGG - Intergenic
1080076873 11:28159473-28159495 AGGTGCTTGCTGAAGGGAAAGGG + Intronic
1080678031 11:34446005-34446027 ATTTACTAGATGAAATGAGAGGG - Intronic
1081110801 11:39130707-39130729 AGGTGCTTGCTGAAAGCAAAGGG + Intergenic
1084792627 11:71484298-71484320 ATGTGGTGGCTGGAAGGAGAAGG - Exonic
1085798435 11:79565012-79565034 ATGTGGAAGCTGAAAAGAAAAGG - Intergenic
1085816136 11:79739205-79739227 ATGAACTAGATGAAATGAGAAGG - Intergenic
1086055503 11:82641792-82641814 TTTTGCTAACTAAAAGGAGAGGG - Intergenic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1090197002 11:124825378-124825400 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
1090269715 11:125377606-125377628 AGGTGGTGGCTGGAAGGAGAGGG - Intronic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1092021495 12:5206498-5206520 ATGTGCTACCTGACAGGGTAAGG + Intergenic
1093062990 12:14626927-14626949 AAGTGATAAATGAAAGGAGAAGG + Intronic
1093546714 12:20357184-20357206 TTCTGCTAGTTGAAAGGAAAAGG - Intergenic
1094137798 12:27147614-27147636 ATTTGCAAGATGAAAGGAGAAGG + Intergenic
1094187126 12:27656688-27656710 GTTTGCAAGATGAAAGGAGAAGG + Exonic
1097638715 12:62153101-62153123 ATTTGCAAGTTGAAAGCAGAAGG + Intronic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1098662029 12:73106737-73106759 AGTTGCTAGCTGAAAACAGAAGG - Intergenic
1098673291 12:73256194-73256216 AGGTGCTTGCTGAAAGCAAAGGG + Intergenic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1099995151 12:89770235-89770257 ACTTGCTAGCTGAAAGTAAATGG + Intergenic
1100397640 12:94198797-94198819 ATTTTCTAGGAGAAAGGAGAGGG - Intronic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1102944530 12:116974294-116974316 AAGAACTACCTGAAAGGAGAAGG + Intronic
1103038981 12:117679065-117679087 AGGTTCAAGGTGAAAGGAGACGG - Intronic
1105297138 13:19097515-19097537 ACCTGCTAGATGAAAGGAGGTGG - Intergenic
1106416285 13:29548662-29548684 ATTTCCTACCTAAAAGGAGAAGG - Intronic
1106474503 13:30086500-30086522 ATGGGCTTCCTGTAAGGAGAAGG + Intergenic
1107566490 13:41610683-41610705 TTGTGCTGCATGAAAGGAGATGG - Intronic
1108072720 13:46644937-46644959 TCCTGCTAGCTGAAAGGAAAAGG - Intronic
1109886752 13:68554408-68554430 ATGTGCTTACTGTAAGAAGAAGG + Intergenic
1109931875 13:69226361-69226383 AGGTGCTAGCTGAAGGCAAAGGG + Intergenic
1110394792 13:75016810-75016832 ATGAGCTAACTGGATGGAGAGGG + Intergenic
1110833869 13:80062673-80062695 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
1115316448 14:32029724-32029746 ATGTGCAACCTGGAAGTAGAAGG - Intergenic
1116354821 14:43914769-43914791 TTGTGCTTGAGGAAAGGAGAGGG + Intergenic
1116471268 14:45288456-45288478 ATATGCAAGATGAAAGGAAATGG + Intergenic
1116609003 14:47042542-47042564 ATGTGCTAGCAAAGAAGAGATGG - Intronic
1116760203 14:49003336-49003358 CTGTCTTAGATGAAAGGAGATGG + Intergenic
1117047908 14:51831208-51831230 ATGTGCTAACACAAAGGAGGAGG - Intronic
1117636585 14:57750991-57751013 GTGTGCTAGATAAACGGAGACGG - Intronic
1118287941 14:64494170-64494192 ATGACCTTGCAGAAAGGAGATGG + Intronic
1118981399 14:70719756-70719778 TTGTGCTGCCTGAGAGGAGAGGG + Intergenic
1119192384 14:72691800-72691822 CTGTGCGAGCGGACAGGAGAAGG + Intronic
1122838248 14:104441948-104441970 AATTGCTGGCTGAAAGGAGCAGG - Intergenic
1123484585 15:20677310-20677332 ATGAGCCATCTGAAAGGACATGG + Intergenic
1123537313 15:21246375-21246397 ATGAGCCATCTGAAAGGACATGG + Intergenic
1126271233 15:46819384-46819406 ATGTGCTATTTGATAGGAGATGG - Intergenic
1126379960 15:48036377-48036399 AAATGCAAGCTGACAGGAGAGGG + Intergenic
1126517671 15:49554197-49554219 TTCTGCTAGAGGAAAGGAGAGGG - Intronic
1127703612 15:61526052-61526074 ATGTGCCAGGGGAAAGGAAAGGG - Intergenic
1128743875 15:70100423-70100445 ATTTGGGAGCTGAGAGGAGAGGG + Intergenic
1129595598 15:76961559-76961581 ATGTGAGAGCTGGAAGGAAATGG - Intergenic
1131864388 15:96691811-96691833 AAGTGCTTTCTGAAAGGTGAGGG - Intergenic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1140602075 16:76488559-76488581 ATGTCTTAGCTAAAAAGAGAGGG + Intronic
1142025439 16:87810437-87810459 GGGTGCTGGCTGAGAGGAGAAGG - Intergenic
1143435456 17:6921266-6921288 ATGTGGCAGCTGTAAGGAGATGG + Intronic
1145785756 17:27592833-27592855 AAGTGTTAGCTCAAAGGAGAAGG - Intronic
1149808859 17:59646803-59646825 AGGTGCTGGAGGAAAGGAGAGGG - Intronic
1150039111 17:61839409-61839431 ATGTGCTTTCTGAAAGGTTATGG - Intronic
1151158463 17:72144254-72144276 ATTTTCCAGCTGACAGGAGATGG - Intergenic
1152445451 17:80340185-80340207 TTGTGCTGGCTGAAGGCAGAGGG - Exonic
1152670413 17:81601008-81601030 CTGTGCCAGATGAAAGGAGGTGG - Intronic
1157908826 18:51595942-51595964 ATGAGCAACCTGAAAGTAGAAGG - Intergenic
1157922270 18:51725570-51725592 ATTTGCTCACAGAAAGGAGATGG + Intergenic
1159172976 18:64796922-64796944 AGGTGCTAGCTGAAAATAGATGG + Intergenic
1159692226 18:71503578-71503600 ATGTGTTAGGTGGAGGGAGATGG - Intergenic
1160035465 18:75297600-75297622 GTGTGCATGCTCAAAGGAGAGGG - Intergenic
1166806911 19:45492961-45492983 AAGTGCTGGCTCGAAGGAGAAGG + Intronic
1166914695 19:46187129-46187151 ATGTGCTACCTGATCAGAGATGG + Intergenic
929086456 2:38172355-38172377 AGATGCTATCTGAAAGAAGAAGG - Intergenic
929424038 2:41825976-41825998 CTGTCCCAGCTGAAAGGAAATGG + Intergenic
931014482 2:57960672-57960694 ATGAGCCAGCAGAAAGGAGATGG - Intronic
931322650 2:61186432-61186454 ATTTGTTAACTGAAAAGAGAGGG - Exonic
931619322 2:64193931-64193953 ATCTGCTGGCTGAATGCAGATGG + Intergenic
932324667 2:70850143-70850165 ATGTGCTAACTAAAGGGAAAAGG + Intergenic
932459975 2:71875813-71875835 CTGGGCTAGCTGGAGGGAGAGGG + Intergenic
932742878 2:74305283-74305305 ATGTCCTATCTGAGAGGTGAGGG - Intronic
934104227 2:88681285-88681307 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
935989433 2:108705845-108705867 TTCTGCTTGATGAAAGGAGAGGG + Intergenic
936551116 2:113440370-113440392 ATGTGAAAACTGAAAGGAAAGGG - Intronic
942002416 2:171661905-171661927 TTGTGCTATTTGAAAGGAGAGGG - Intergenic
942185322 2:173419995-173420017 ATGAGCTGGATGAAAGGAGAGGG - Intergenic
942247050 2:174017426-174017448 AAGTGCTAGCAGAAAGAAAAGGG + Intergenic
942334040 2:174861776-174861798 ATGTGCCACCTGAAATAAGAAGG + Intronic
942490193 2:176482250-176482272 ATGTTGGAGCTGAAAGGACAAGG - Intergenic
942558291 2:177194762-177194784 ATGTGCTAAGAGAAAGGAAAAGG + Intergenic
942975713 2:182015093-182015115 TTCTGCTAGAAGAAAGGAGAGGG - Intronic
943704340 2:191019260-191019282 AAATGGTAGCTGGAAGGAGAGGG - Intronic
944104947 2:196069516-196069538 ATGTGGAAGCTGAAATGTGAAGG + Intergenic
945323694 2:208457668-208457690 AGGTGTTATCTGTAAGGAGAGGG + Intronic
947476827 2:230457572-230457594 ATATGCTTGGGGAAAGGAGAAGG - Intronic
947496709 2:230643047-230643069 ATGGGCTCGCTGAAAGGAGCTGG + Intergenic
948340186 2:237244427-237244449 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
1168797185 20:619276-619298 GTGTGAGAGCTGAAAGAAGAAGG + Intergenic
1170297126 20:14839985-14840007 ATATACTAGCTGCAAGTAGAAGG - Intronic
1172600896 20:36182258-36182280 AGGGGCTACCTGAGAGGAGATGG - Exonic
1173504457 20:43575984-43576006 ATAAGCTAGATGAAAAGAGATGG + Intronic
1174931334 20:54818365-54818387 AGGTGCTTGCTGAAGGGAAAAGG + Intergenic
1179527356 21:41990981-41991003 ATGTGATTGCTGAAAGGGGTGGG + Exonic
1180171349 21:46060270-46060292 TTGTGCTTGCTGAAGGCAGATGG - Intergenic
1180535292 22:16390031-16390053 ATGAGCTAGCTGTGAGGACAGGG - Intergenic
1182825391 22:33260404-33260426 ATGTGCTAGCTGGAAGGCATGGG + Intronic
1182853939 22:33500929-33500951 AGGTGCTAGCTCAGGGGAGAGGG + Intronic
1183760077 22:39808202-39808224 ATGTCCAAGCTGGAATGAGAGGG - Intronic
1184785331 22:46668785-46668807 ATGAACAAGCTGGAAGGAGACGG - Exonic
949682062 3:6525557-6525579 AAGAGCTGACTGAAAGGAGATGG - Intergenic
950571524 3:13803155-13803177 ATGTGCATGCTGGGAGGAGAAGG + Intergenic
953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG + Intergenic
955071700 3:55577311-55577333 TTATGCCAGTTGAAAGGAGAAGG + Intronic
956274006 3:67478123-67478145 TTGAGCTAGCTGATAAGAGAAGG - Intronic
956489850 3:69759416-69759438 ATGTGAGAGCTGAAATGAGAAGG + Intronic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
957738010 3:84226942-84226964 ATGTGCTAGCAGACAGGGGAAGG + Intergenic
959548275 3:107623445-107623467 ATGTGGCAGCTAAAAGTAGAAGG - Intronic
959998144 3:112700236-112700258 AGGTGCTTGCTGAAAGCAAAGGG + Intergenic
960196593 3:114776120-114776142 CAGTGCTAGCGGAAAGGAGAAGG + Intronic
960494482 3:118358816-118358838 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
965145109 3:164890827-164890849 ATGTGCTTGCGGGAGGGAGAGGG - Intergenic
966434392 3:179867142-179867164 ATTTGGTAGTTGAAGGGAGATGG - Intronic
967894588 3:194385717-194385739 ATGGGCTAACAGGAAGGAGAAGG - Intergenic
969605878 4:8202075-8202097 ATGTGCTTCCGGAGAGGAGATGG + Intronic
969899614 4:10336647-10336669 ATGAGCTAGCTGAGAGGATGAGG + Intergenic
969943822 4:10762204-10762226 ATGTTCTAGTGGAAAAGAGATGG + Intergenic
970071261 4:12162351-12162373 TTCTGCTAGAGGAAAGGAGAAGG - Intergenic
970471010 4:16379343-16379365 ATGTGCCAGCAGACAGGGGAAGG + Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971677625 4:29654028-29654050 GTGGGCTAGCAGAAGGGAGAGGG + Intergenic
972095755 4:35344749-35344771 AGGTGCTTGCTGAAAGCAAAAGG + Intergenic
974243398 4:59282264-59282286 AAATGCTTGCTGAAAGGAAAGGG - Intergenic
974459275 4:62166201-62166223 AGGTGCTTGCTGAAGGCAGAGGG + Intergenic
975506750 4:75146748-75146770 AAGTGCTGGCTAAAAGAAGAAGG - Intergenic
977110656 4:92949928-92949950 ATGGGTTAGCTGAGAGGAGATGG - Intronic
978400496 4:108325536-108325558 GTGTGCAAACTGAAAAGAGATGG + Intergenic
978654365 4:111048970-111048992 ATCTGCTTGAGGAAAGGAGAAGG + Intergenic
978771876 4:112465840-112465862 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
979124309 4:116948389-116948411 ATATCCTAGCTGTAAGGGGAGGG - Intergenic
981013661 4:139951600-139951622 AGGAGCCAGCTGCAAGGAGAGGG - Intronic
981048563 4:140289314-140289336 ATATGCTGGCTCAGAGGAGATGG - Intronic
981400099 4:144303639-144303661 CTATGGTAACTGAAAGGAGATGG + Intergenic
983493070 4:168411840-168411862 TTCTGCTTGCTGAGAGGAGAGGG + Intronic
984768336 4:183416928-183416950 AGGCTCTAGCTGAAAAGAGAGGG + Intergenic
985072142 4:186176787-186176809 ATCTGCTAGGTGAATGGACAAGG + Intergenic
988267497 5:28971429-28971451 AGGTGCTTGCTGAAAGCAAAGGG - Intergenic
988459967 5:31426179-31426201 ATGGGGTAGATGAAAGGAAATGG - Intronic
989031629 5:37125280-37125302 ATGAGCTGGCAGAAAAGAGAGGG - Exonic
990076936 5:51857904-51857926 ATATGATTGCAGAAAGGAGATGG - Intergenic
990202052 5:53386605-53386627 ATGTGCTAGGTAAAAGGAACTGG - Intergenic
990202909 5:53397915-53397937 CTTTGCTAGAGGAAAGGAGAGGG - Intergenic
992611660 5:78513345-78513367 ATGTTTTAGCATAAAGGAGAGGG - Intronic
992612372 5:78518662-78518684 ATGTGCCAGCTGGGAGGAGGTGG + Intronic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
993231644 5:85245559-85245581 ATGTGCTTGCTGAAGGCAAAGGG - Intergenic
994414165 5:99447282-99447304 ATGTGCCAGATAAAAGGAAAGGG + Intergenic
995945846 5:117644913-117644935 ATGTGGTGGCTGAAACGTGAGGG + Intergenic
996533081 5:124546576-124546598 ATGAGGGAGGTGAAAGGAGATGG + Intergenic
999037043 5:148363359-148363381 ATCTGCTAGCTGAATGGTGCAGG + Intergenic
999708955 5:154299442-154299464 ATGACATAGCTGAAAAGAGATGG + Intronic
1001732322 5:173969457-173969479 ATGTGCCAGCTGACTGCAGAAGG - Intergenic
1003260807 6:4513767-4513789 ATGTTCTAGATCAAAGGAAATGG + Intergenic
1007732343 6:43954771-43954793 ATGTGCCCGCTCCAAGGAGAGGG + Intergenic
1009896563 6:69758420-69758442 GAGTGCCAGCTGAAAGGAAATGG - Intronic
1010314713 6:74434354-74434376 ATGTGATGGATGAATGGAGAAGG + Intergenic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1010740186 6:79493682-79493704 AGTTGCTTGCTGAAAGGAAAAGG - Exonic
1010937924 6:81883992-81884014 AGGTGCTAGCTGAAGGCAAAGGG - Intergenic
1012980803 6:105828796-105828818 AGGAGCTAGCAGAAAGGGGAGGG + Intergenic
1013834463 6:114317426-114317448 AGGTGCTAACTGAAATGTGAAGG + Intronic
1014610679 6:123540999-123541021 ATGTGCTAGTTGACTGCAGATGG - Intronic
1014730103 6:125022498-125022520 ATGTGCTAATTGAAAGAAAAAGG - Intronic
1015391832 6:132691047-132691069 ATATGCTAGCAAATAGGAGATGG + Intronic
1015950213 6:138545616-138545638 ATGTTCTGTCTGAAAGGTGAGGG - Intronic
1017065516 6:150525671-150525693 ATGTGGTAGCTGAAAGGACAGGG - Intergenic
1018564947 6:165141473-165141495 ATGTCCTAGCTGCAGGCAGAAGG - Intergenic
1022438272 7:30410796-30410818 CTGTGCTGGCTGATAGGAAATGG - Intronic
1022571601 7:31459116-31459138 ATGTGTGAGCTTAAAGGAGAAGG - Intergenic
1022582463 7:31569541-31569563 ATGTACTGGCTCAATGGAGAGGG - Intronic
1023250781 7:38258737-38258759 ATGTGCAAGCAGAAAGGAAGGGG + Intergenic
1023252326 7:38278361-38278383 ATGTGCAAGCAGAAAGGAAGGGG + Intergenic
1023737382 7:43247282-43247304 ATGTGCTAGATGGCAGGACATGG + Intronic
1024844756 7:53629820-53629842 ATGTGCTTGTTGACAGAAGAAGG + Intergenic
1026382697 7:69815232-69815254 ATGTGCAAGCTGCAAGGTAAAGG - Intronic
1027680864 7:81219785-81219807 ATGAGCTAACTGAAAGGTGATGG + Intergenic
1030355688 7:108539470-108539492 AGGTGCTTGCTGAAAGCAAAGGG + Intronic
1031682275 7:124689195-124689217 AAGTGCTTGCTGAAAGCAAAGGG + Intergenic
1032553307 7:132805803-132805825 ATGTGGTAACTGAGAGGACATGG + Intronic
1033650973 7:143343390-143343412 ATGTGAAAGCTGAAACAAGAAGG + Intronic
1035441227 7:158902730-158902752 ATGTGGTAGCTGCAAGGGCATGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1038583670 8:28771072-28771094 ATCTGCGAGCTGAAAGCAAAGGG + Exonic
1038696336 8:29810059-29810081 ATTTGCTAGCTGGAACAAGAGGG - Intergenic
1038875148 8:31540291-31540313 ATGTGTTAGCTTAAAAGAGTTGG + Intergenic
1039789495 8:40863428-40863450 ATGAGGTAGCTAAAGGGAGAAGG + Intronic
1043218701 8:77630054-77630076 ATGTGATAGGTGATATGAGAAGG - Intergenic
1043231789 8:77811864-77811886 ATGTCCTTGCTCAAATGAGAAGG + Intergenic
1044448064 8:92301452-92301474 ATGTGAGAGCTGAAATGAGAAGG - Intergenic
1044964382 8:97560986-97561008 ATGTCCTGGCTCTAAGGAGATGG + Intergenic
1045397205 8:101772848-101772870 ATGGGTTACCTCAAAGGAGAGGG + Intronic
1045677076 8:104619079-104619101 ATGAGCTTGCTGAGAAGAGATGG + Intronic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1046718928 8:117597186-117597208 AGGTGCTAGCTTAGAGGAAAGGG + Intergenic
1047268897 8:123335821-123335843 ATGCGATAGGTGAAAGCAGAAGG + Intronic
1048715752 8:137266882-137266904 ATGCACTATCTGAAAAGAGATGG - Intergenic
1049901873 9:176763-176785 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1051829104 9:21256166-21256188 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1051851019 9:21508099-21508121 ATGAGATACCTGAAAGGGGATGG + Intergenic
1052307950 9:27032232-27032254 TTTTGGAAGCTGAAAGGAGATGG - Intronic
1053744907 9:41187051-41187073 ATGTGAAAACTGAAAGGAAAGGG + Intronic
1054482364 9:65678168-65678190 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1054683441 9:68244218-68244240 ATGTGAAAACTGAAAGGAAAGGG - Intronic
1057433680 9:95019928-95019950 ATGTGCTAGTCCTAAGGAGAAGG + Intronic
1061346542 9:130030847-130030869 ATTTGCTAGCTTAAAAGAGCTGG + Intronic
1061936361 9:133859699-133859721 ATGGGCTGGTGGAAAGGAGAAGG + Intronic
1186950037 X:14614390-14614412 AGGTGATAGCTAAGAGGAGATGG - Intronic
1187775654 X:22753791-22753813 ATTTGGTAGCGGAAAGAAGATGG + Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1188871841 X:35382522-35382544 ACATGCTGGCTGAAAGGAGTGGG + Intergenic
1188907684 X:35808080-35808102 ATGTGCACACTGGAAGGAGATGG - Intergenic
1189337667 X:40180136-40180158 AAGTCCTAGCAGCAAGGAGAGGG + Intergenic
1193213903 X:78840033-78840055 CTGTGCTTGAGGAAAGGAGATGG + Intergenic
1193331229 X:80237646-80237668 ATGTGCTAGCAGACAGGGGAAGG + Intergenic
1193356500 X:80525097-80525119 AGGTGCTTGCTGAAAGCAAAGGG + Intergenic
1193732227 X:85115452-85115474 ATGTGCCAGAAGACAGGAGAAGG + Intergenic
1194170526 X:90575189-90575211 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1194394437 X:93363888-93363910 ATTTGACAACTGAAAGGAGACGG + Intergenic
1194675663 X:96790755-96790777 ATGTGACAGCTAACAGGAGAAGG + Intronic
1195509328 X:105696391-105696413 ATGTGCTATCTGAAGGGATGTGG + Intronic
1196783467 X:119402641-119402663 CTGTGCTGGCTGAAAGGAAGGGG + Intronic
1197551727 X:127900342-127900364 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1197994233 X:132354823-132354845 ATGTGTAAGCAGAAAGGAAAGGG + Intergenic
1198761625 X:140038731-140038753 TTTTGCTTGCAGAAAGGAGAGGG + Intergenic
1199367774 X:147007160-147007182 ATGTGCTTGCTGAAAGCAAAGGG + Intergenic
1199944354 X:152653451-152653473 ATGTTCTAGCTGGAAGGGAAGGG + Exonic
1200516769 Y:4152949-4152971 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic