ID: 970926872

View in Genome Browser
Species Human (GRCh38)
Location 4:21462202-21462224
Sequence GTGAAAACACACAAATACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 0, 2: 25, 3: 222, 4: 1014}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970926872_970926876 6 Left 970926872 4:21462202-21462224 CCCATGTATTTGTGTGTTTTCAC 0: 1
1: 0
2: 25
3: 222
4: 1014
Right 970926876 4:21462231-21462253 GATAAAGATATACCCAAGACTGG 0: 101
1: 1522
2: 3807
3: 6517
4: 9352
970926872_970926877 7 Left 970926872 4:21462202-21462224 CCCATGTATTTGTGTGTTTTCAC 0: 1
1: 0
2: 25
3: 222
4: 1014
Right 970926877 4:21462232-21462254 ATAAAGATATACCCAAGACTGGG 0: 145
1: 2636
2: 5161
3: 9820
4: 11568
970926872_970926880 27 Left 970926872 4:21462202-21462224 CCCATGTATTTGTGTGTTTTCAC 0: 1
1: 0
2: 25
3: 222
4: 1014
Right 970926880 4:21462252-21462274 GGGAAATTTACAAAAGAAAAAGG 0: 7
1: 200
2: 1960
3: 2613
4: 7461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970926872 Original CRISPR GTGAAAACACACAAATACAT GGG (reversed) Intronic
900581312 1:3411176-3411198 GTGCGTACACACAAATACACAGG - Intronic
900725708 1:4215207-4215229 GTGAAAACACAGACACACACAGG - Intergenic
900727492 1:4226651-4226673 TTTAAAACACCCAAAAACATAGG - Intergenic
900773977 1:4567850-4567872 ATGAAAACAGACTAATACACCGG + Intergenic
900817496 1:4859731-4859753 GTGAGAACAGACTAATACAAAGG + Intergenic
900859672 1:5219196-5219218 GTGAGAACAGACTAATACAATGG + Intergenic
901189348 1:7397305-7397327 GTGATACCACAGAAATACAAAGG - Intronic
901406116 1:9047145-9047167 GTGAAAACAGACTAATACACAGG + Intronic
901440807 1:9277077-9277099 GTGAAAACAGACTAATACACAGG - Intergenic
901784131 1:11613389-11613411 GTGAGAACAGACGAATACAGTGG + Intergenic
902124009 1:14193275-14193297 ATGAAAACAGACTAATACACTGG + Intergenic
902153201 1:14461567-14461589 GTGAAAACGGACTAATACAGAGG + Intergenic
902172307 1:14621901-14621923 GTGAGAACAGACTAATACAATGG + Intronic
902570766 1:17345797-17345819 GTGAAAACGGACTAATACACGGG + Intronic
902634748 1:17727894-17727916 GTGACAACAGACTAATACACTGG - Intergenic
902674142 1:17996748-17996770 GTGAGAACAGACTAATACAGGGG - Intergenic
902982164 1:20132282-20132304 GTGAAAACGGACTAATACAATGG - Intergenic
903129169 1:21267253-21267275 GGGAAAACAGACTAATACACTGG - Intronic
903487824 1:23704567-23704589 GTGAAAACAGACTAATACAATGG - Intergenic
903556879 1:24200453-24200475 ATGAAAACAGACTAATACAGGGG + Intergenic
904375266 1:30077372-30077394 GTGAGAACAAACTAATACAGTGG + Intergenic
905305175 1:37012964-37012986 GTGAAAACAGACTAATACAGGGG - Intronic
905502208 1:38448776-38448798 GTGAACACAAAGAAAGACATTGG + Intergenic
905741094 1:40372525-40372547 TTAAAAACACACAAGTTCATTGG - Intronic
905766003 1:40601588-40601610 GTGAGAACAGACTAATACAGCGG + Intergenic
906038768 1:42769874-42769896 CTGAACACACACCAATACCTGGG - Intronic
906972047 1:50525731-50525753 ATAAAAACACACAATTAAATAGG - Intronic
907353270 1:53851008-53851030 ATGAAAACAGACTAATACAGAGG + Intergenic
907727167 1:57030333-57030355 ATGAAAACAGACTAATACAGAGG + Intronic
907776658 1:57522448-57522470 GTGAGAACAAACTAATACAGAGG - Intronic
907853407 1:58278402-58278424 GTGAGAACAGACTAATACAAAGG + Intronic
907977672 1:59447853-59447875 GTGAAAATGGACTAATACATTGG + Intronic
908071003 1:60460159-60460181 GGGAAAACACTCCAAGACATTGG + Intergenic
908135044 1:61123182-61123204 GAGACAACATTCAAATACATAGG + Intronic
908248234 1:62244725-62244747 GTGAAAACAGACTAATACAGGGG + Intronic
908783626 1:67714099-67714121 GTTAAAACACACACACACAATGG - Intronic
908851392 1:68380370-68380392 GTGAGAACAGACCAATACACAGG - Intergenic
908919432 1:69171337-69171359 GTAAAAACAGACTAATACAGAGG + Intergenic
909109179 1:71452684-71452706 GTGAAATCTCACAATTTCATAGG - Intronic
909265127 1:73549058-73549080 GTGAAAACAGACTAATAAAGTGG - Intergenic
909301422 1:74017599-74017621 GAGAAAATCCACAAATCCATGGG + Intergenic
909371359 1:74886297-74886319 GTGAAAACAGACTAATACAAGGG + Intergenic
909495802 1:76277249-76277271 GTAAATACACACACACACATAGG - Intronic
909500983 1:76335546-76335568 GAGAAAACCCACACAGACATGGG + Intronic
909706006 1:78585592-78585614 TTGAACACAGACAAATACAGAGG - Intergenic
910353460 1:86327168-86327190 ATAAACACACACAAATACACTGG + Intergenic
910534313 1:88279147-88279169 CTGAAAACAGACTAATACAGAGG - Intergenic
910553402 1:88502097-88502119 ATGATAAGAGACAAATACATTGG - Intergenic
910722972 1:90307796-90307818 GTTAAAACACACATAAACCTAGG - Intergenic
911005743 1:93220822-93220844 ATGAGAACACACGAAGACATGGG - Intronic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911391882 1:97255663-97255685 ATGAAAACAGACTAATACAGAGG + Intronic
911419342 1:97620035-97620057 GTGAAAAAAAAAAAAAACATAGG + Intronic
911824738 1:102467375-102467397 GTGTATATACACACATACATAGG - Intergenic
912028355 1:105206573-105206595 GTGAGAATACACTAATACAGTGG - Intergenic
912142797 1:106752048-106752070 ATGAAAACACATAACTACACTGG + Intergenic
913216057 1:116621331-116621353 GTGAGAACTGACTAATACATAGG + Intronic
913553434 1:119939124-119939146 GAGAAAACCCACACAGACATGGG + Intronic
913566149 1:120074464-120074486 GTGAAGACAGACTAATACAGTGG + Intergenic
913631981 1:120719089-120719111 GTGAAGACAGACTAATACAGTGG - Intergenic
914286737 1:146233823-146233845 GTGAAGACAGACTAATACAGTGG + Intergenic
914547768 1:148684564-148684586 GTGAAGACAGACTAATACAGTGG + Intergenic
914618742 1:149385789-149385811 GTGAAGACAGACTAATACAGTGG - Intergenic
916705811 1:167348620-167348642 AGGAAAATACACAAAAACATTGG - Intronic
917396458 1:174599954-174599976 ATGAAAACAGACTAATACATGGG - Intronic
917593983 1:176508971-176508993 GTGAAAACGGACTAATACAATGG + Intronic
917594009 1:176509312-176509334 GTGAAAACGGACTAATACAATGG - Intronic
917700914 1:177580271-177580293 GTGAAAATGAACTAATACATAGG - Intergenic
917748440 1:178033430-178033452 TTGAAAACAGATAAATAAATAGG - Intergenic
917821262 1:178766548-178766570 GTGAGAACTAACCAATACATAGG + Intronic
917879794 1:179323341-179323363 TTGAAAACAAACAAATACAAAGG - Intronic
918056372 1:181025236-181025258 CCGAAAACACACAAATATACTGG - Intergenic
918453703 1:184685702-184685724 CTGAAATCAAAGAAATACATTGG - Intergenic
918470843 1:184871383-184871405 GTGGACACAGACACATACATAGG + Intronic
918719982 1:187840519-187840541 GTGAAAACAAACAAAAACTAGGG - Intergenic
918740363 1:188123051-188123073 GTGAGAACACACACAGACACAGG + Intergenic
918861567 1:189832873-189832895 GAGAAAAGTCACACATACATGGG + Intergenic
918987870 1:191656970-191656992 GTGAGAACTCAGGAATACATAGG - Intergenic
919259140 1:195167218-195167240 CTGTGACCACACAAATACATAGG + Intergenic
919559928 1:199104644-199104666 TGGAAAATTCACAAATACATGGG - Intergenic
921078305 1:211717564-211717586 GTGAGAACAGACTAATACAGGGG + Intergenic
921513723 1:216064432-216064454 GAGAAAACCCACAAAAACATGGG + Intronic
921530468 1:216276575-216276597 GTGAAAACAGACGAGTACACTGG - Intronic
921640695 1:217548938-217548960 ATGAAAACAGACTAATACATGGG + Intronic
921771617 1:219047329-219047351 GGGAATATACACAAATATATAGG - Intergenic
921856699 1:219994170-219994192 GAGAAAACTCACACAGACATGGG - Intronic
922131388 1:222783047-222783069 CTGAAACCACAAAAATACAAAGG + Intergenic
922140212 1:222877202-222877224 GTGAAAACAGACTAACACAAAGG - Intronic
922390117 1:225132411-225132433 ATGAGAACACACAGACACATGGG - Intronic
922644063 1:227267553-227267575 GTGAAAACAGACTAATACACTGG - Intronic
922956029 1:229601372-229601394 GTGATAAGACAAAAATACTTTGG + Intronic
923170413 1:231411414-231411436 GTGAAAACAGACAAACACAATGG + Intronic
923311855 1:232743131-232743153 GTGAAAACGGACTAATACATGGG + Intergenic
923825003 1:237490394-237490416 GAGAAAACAAACAAAAACATCGG + Intronic
923992105 1:239450234-239450256 GGAAAAATACACAAATACAAAGG + Intronic
924000059 1:239541131-239541153 GAGAAAACCCACACAGACATGGG - Intronic
924034497 1:239922577-239922599 GAGAAAACCCACATAAACATGGG - Intergenic
924198216 1:241632345-241632367 ATGAGAACACACTAATACAGAGG + Exonic
924357029 1:243189805-243189827 GTTAACACTCACAAACACATAGG - Intronic
924834845 1:247637895-247637917 GTGAAAACACAAATATGCTTGGG + Intergenic
924837305 1:247663907-247663929 GAGAAAACGCACAAACACAAAGG - Intergenic
1063625318 10:7684083-7684105 GTGAAAACAAAAAATGACATTGG + Intergenic
1063729106 10:8675918-8675940 GTGAAAACAGACTAATATACTGG - Intergenic
1063840124 10:10062064-10062086 ATGAACACACATAAGTACATGGG + Intergenic
1064116847 10:12585446-12585468 GTGAAAACGGACAAATACAGTGG - Intronic
1064173891 10:13057410-13057432 GTGAAGCCACATAAACACATCGG + Intronic
1064217526 10:13412899-13412921 GTGAGAACAGACAAATAGATTGG - Intergenic
1064388370 10:14919971-14919993 GGGAAATCACACAACTACTTTGG + Intronic
1064556341 10:16550540-16550562 GTGAAAACAGACAAATACAAGGG + Intergenic
1065139415 10:22705823-22705845 GTGAGAACAGACTAATACAATGG - Intronic
1065536779 10:26722541-26722563 GTAAAAATACAAAAATACCTGGG + Intronic
1065601328 10:27371769-27371791 GTGAAAACAGACTAATACAGAGG + Intergenic
1066058818 10:31704692-31704714 GTGAGAACAGACTAATACAAAGG + Intergenic
1066484691 10:35832097-35832119 GTGAAAACAGACTAATACACTGG - Intergenic
1066659265 10:37723918-37723940 TTGATAACACAGAAATACAAAGG + Intergenic
1067201331 10:44174645-44174667 ATGATAGCACAGAAATACATAGG - Intergenic
1067305290 10:45058660-45058682 GTGAAAACAGACTAATACACTGG - Intergenic
1067322933 10:45239551-45239573 GTGAAAACACCCAAACTCAAGGG - Intergenic
1067422754 10:46171104-46171126 GTGAGAACACATGAACACATGGG + Intergenic
1068113055 10:52704336-52704358 CTGAAAACATAAAAATAAATGGG + Intergenic
1068305408 10:55200989-55201011 ATGAAAACAGACTAATACAGAGG + Intronic
1068457356 10:57273936-57273958 CTGAAACCACAGAAATACAAAGG + Intergenic
1068781918 10:60928832-60928854 GTGAGAACAGACTACTACATTGG - Intronic
1068850071 10:61728113-61728135 TTGAAAGCATACAAAGACATGGG + Intronic
1068894345 10:62182854-62182876 GAGAAAACCCACACAGACATGGG + Intergenic
1069133660 10:64736912-64736934 ATGAAAACGGACTAATACATGGG + Intergenic
1069224461 10:65924700-65924722 GTGAGAACAAACTAATACAAGGG - Intronic
1069241817 10:66150410-66150432 GTGAAAGCAGACTAATACAATGG + Intronic
1069243555 10:66172435-66172457 TTAAAAACAAACAATTACATAGG - Intronic
1069279473 10:66637273-66637295 TTGAAAACAACTAAATACATAGG - Intronic
1069773205 10:70912209-70912231 GTGACAACAGACTAATACATGGG - Intergenic
1069787725 10:70999621-70999643 GTGCACACACACAGAGACATAGG - Intergenic
1070450153 10:76549813-76549835 TGAAAACCACACAAATACATGGG + Intronic
1070578749 10:77702520-77702542 ATGATAAACCACAAATACATTGG - Intergenic
1070777473 10:79118258-79118280 GTGAACAAACAGAAAAACATGGG - Intronic
1070859619 10:79640441-79640463 TGGAAAACATACAAACACATAGG + Intergenic
1070895158 10:79977104-79977126 ATGAAAACAGACTAATACAGTGG + Intronic
1071584298 10:86804697-86804719 GTTTAAAAACACAAATACTTGGG - Intronic
1071788412 10:88929143-88929165 GTGAAAACAGACTAGTACAGTGG - Intronic
1071980860 10:91003326-91003348 GTGAGAACAGACTAATACAGTGG - Intergenic
1072004932 10:91235923-91235945 GTGAAAACAGACTAATACAGTGG + Intronic
1072465514 10:95658559-95658581 GTGAAAACAGACTAATACAATGG + Intergenic
1072602675 10:96943817-96943839 TTGAAAGCACTCAAATATATTGG - Intronic
1072678456 10:97487249-97487271 TGGAAAACAAACAAAAACATTGG + Intronic
1073639680 10:105238919-105238941 TTAAAAACACACAAAGACAAAGG + Intronic
1073947140 10:108764199-108764221 TTGAAAACAGAAACATACATGGG - Intergenic
1073971886 10:109053053-109053075 ATGAGAACAGACAAATACAGTGG + Intergenic
1074207944 10:111300761-111300783 GTGAAAATGGACTAATACATGGG + Intergenic
1074337149 10:112589521-112589543 GTGAAAACGAACTAATACAGGGG + Intronic
1074340816 10:112627585-112627607 GACAAAACATACGAATACATAGG - Intronic
1074409074 10:113209493-113209515 AAGAAAATTCACAAATACATGGG + Intergenic
1074421951 10:113316935-113316957 GTGAAAACAGTCTAATACAGGGG - Intergenic
1074468002 10:113701109-113701131 TTGAGAACAGACCAATACATAGG + Intronic
1074671293 10:115795482-115795504 GTGAGAACGGACTAATACATGGG - Intronic
1074971131 10:118539829-118539851 ATGAAAACACATGAACACATAGG - Intergenic
1075305522 10:121364353-121364375 GTGAAAACAGACTAATACAGGGG + Intergenic
1075442160 10:122488404-122488426 GTAAAAATACAAAAATACAAAGG + Intronic
1075545532 10:123351819-123351841 GTGAAACCACTCAGATAAATGGG - Intergenic
1075859783 10:125664786-125664808 GTGAAAACAGACTAATACAGTGG + Intronic
1076065281 10:127443474-127443496 GGGAAAACAGACAAAGACAAAGG - Intronic
1076098724 10:127756420-127756442 GTGAAAACACATATATCTATTGG + Intergenic
1076709931 10:132327401-132327423 ATGAAAACAAACTAATACAGAGG + Intronic
1077165725 11:1136983-1137005 GTGAAAACACACCACAACATGGG + Intergenic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1077684318 11:4276767-4276789 GAGAAAAACCACAAAGACATGGG + Intergenic
1077685721 11:4290001-4290023 GAGAAAAACCACAAAGACATGGG - Intergenic
1078049959 11:7955354-7955376 GTTAAAGTACACAAATACAGGGG + Intergenic
1078069262 11:8097580-8097602 GTGCACACACACAAATGCACTGG - Intronic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1078442104 11:11376846-11376868 GTGAAGACAGACAAAATCATTGG - Intronic
1078539246 11:12200119-12200141 CTGAACACACAGAAATACAGAGG + Intronic
1078750048 11:14153247-14153269 GTGAGAGCAGACTAATACATGGG - Intronic
1078827789 11:14947509-14947531 CTGAACACACACACACACATAGG - Intronic
1079554245 11:21739794-21739816 GTGAAAATAGACTAATACAGTGG - Intergenic
1079665823 11:23104245-23104267 ATGAAAACAATCTAATACATGGG + Intergenic
1079670648 11:23165983-23166005 GTGAAAATGGACAAATACAGTGG + Intergenic
1079843932 11:25439913-25439935 ATGAAAAATCACAAATACATAGG + Intergenic
1080206153 11:29731918-29731940 ATGAAAACAGACTAATACATGGG - Intergenic
1080223245 11:29931519-29931541 GTGAGAACAGACTAATACAGTGG + Intergenic
1080723891 11:34875539-34875561 GTGAAAACAGACTAATACACCGG + Intronic
1080841322 11:35985897-35985919 GTGAGAACAGACTAATACAGTGG + Intronic
1080936120 11:36865670-36865692 GTCAAAACACCAAAATAAATAGG + Intergenic
1081108148 11:39099153-39099175 GTGAAAACGGACTAATACAATGG - Intergenic
1081201556 11:40222304-40222326 TTTAATACAAACAAATACATGGG - Intronic
1081283102 11:41235218-41235240 GTGACAAAAGAGAAATACATTGG + Intronic
1081305597 11:41508262-41508284 GTGAGAACAGACTAATACAATGG + Intergenic
1081334611 11:41849031-41849053 GTGAAAACAGACTAATACATAGG + Intergenic
1081583942 11:44371417-44371439 ATGAAAACAGACAAATACAAGGG + Intergenic
1081886449 11:46501243-46501265 GAGAAAACCCACACAGACATGGG - Intronic
1082194612 11:49287427-49287449 GTGAAAACAAACTAATACAAAGG - Intergenic
1083012379 11:59415459-59415481 GTGAAAACAGACTAATACAGTGG + Intergenic
1083042982 11:59706106-59706128 ATGAAAATAAACAAATACAAAGG + Intergenic
1083065043 11:59915597-59915619 ATGAAAACAGACTAATACAGAGG - Intergenic
1083481995 11:62955086-62955108 GTGAGAACAGACTAATACACTGG - Intronic
1085249973 11:75136633-75136655 GTGAAAACAGACTAATACAGAGG + Intronic
1085558401 11:77447021-77447043 ATTAAAACACATAAAGACATAGG + Intronic
1085594335 11:77794378-77794400 TAGAAACCATACAAATACATGGG + Intronic
1085866254 11:80297473-80297495 ATATAAACACTCAAATACATGGG - Intergenic
1086273215 11:85093465-85093487 GTGAAAACAGACTAATACACTGG - Intronic
1086671516 11:89553501-89553523 GTGAAAACAAACTAATACAAAGG + Intergenic
1086836911 11:91636745-91636767 GTGAGAACAGACTAATACAAAGG - Intergenic
1086896339 11:92317364-92317386 GTGAAAACAACCAAATCCTTTGG - Intergenic
1087133290 11:94688335-94688357 TAGAAAACTCACAAATACACAGG + Intergenic
1087203923 11:95374199-95374221 CTGACAACACAGAAATAAATGGG + Intergenic
1087777703 11:102271712-102271734 TTGAAAACACCCAAATAGCTGGG - Intergenic
1087814007 11:102638570-102638592 GTGAAAACAGACTAATACAAGGG - Intergenic
1088100541 11:106149833-106149855 GTGAAAAAACCCAAAGACATTGG + Intergenic
1088317812 11:108525238-108525260 ATGAAAACAAACTAATACACAGG + Intronic
1088869306 11:113877700-113877722 GTGAGAACAGACTAATACAAAGG - Intergenic
1089858136 11:121565284-121565306 GAGAAAACACACACATCCAGAGG - Intronic
1090032964 11:123223133-123223155 GTGAGAACAGACTAATACAGAGG + Intergenic
1090367258 11:126217093-126217115 GAGAAAACCCACACAGACATGGG + Intronic
1090928782 11:131277016-131277038 GTGAGAACAAACAAATACAGTGG + Intergenic
1091043136 11:132301032-132301054 GTGAGAACAGACTAATACAGAGG - Intronic
1091272748 11:134329521-134329543 GTGAAAATACTCAAATCCCTGGG - Intergenic
1091318161 11:134630684-134630706 GTGTATACACACACATACACAGG - Intergenic
1091364461 11:135006159-135006181 GTGAAAACCCATAAATACCGAGG + Intergenic
1091549290 12:1525806-1525828 GTGAAAACGGACAAATACAGTGG - Intergenic
1091967523 12:4757222-4757244 GTGAAAACAGACAAATGCAGTGG + Intronic
1092330108 12:7578968-7578990 GTGAAAACAAACTAATACAATGG - Intergenic
1092874129 12:12833511-12833533 GTGAAGACACAAAGATATATGGG - Intergenic
1092874209 12:12834001-12834023 ATGAAAACAGATTAATACATGGG + Intergenic
1092899882 12:13048721-13048743 GTGAAAACAGACTAATACATTGG - Intronic
1093254971 12:16855747-16855769 GTGAACACACACATACACACAGG - Intergenic
1093574966 12:20716440-20716462 CTTAAAACACACATATTCATGGG - Intronic
1093943927 12:25085918-25085940 ATGCAAACCCACAAATACAGAGG + Intronic
1094345018 12:29458368-29458390 GTGCAAAAAAAAAAATACATTGG + Intronic
1094716349 12:33018491-33018513 ATGAAAACAAACTAATACATTGG + Intergenic
1094721441 12:33068690-33068712 ATGAGAACACATAAACACATGGG + Intergenic
1095145702 12:38723117-38723139 GTGAGAACAGACTAATACAGGGG + Intronic
1095314047 12:40737303-40737325 GTGTATATACACATATACATGGG + Intronic
1095327273 12:40910939-40910961 GTGAAAACAGACTAATACAATGG - Intronic
1095381136 12:41594163-41594185 GTCAATATACAAAAATACATTGG - Intergenic
1095600354 12:44006040-44006062 ATGAAAACGGACTAATACATAGG + Intronic
1095766030 12:45896674-45896696 GTGAAAACGGACTAATACAAAGG + Intronic
1097357674 12:58620493-58620515 GTAAAAACAGACTAATACGTGGG + Intronic
1097494276 12:60310651-60310673 TGGAATACACACAAATAAATAGG + Intergenic
1098130229 12:67342392-67342414 GTGATAACACAGAAATAAAAAGG - Intergenic
1098310948 12:69148469-69148491 GTGAAAACAAATGAATACACTGG + Intergenic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1098766941 12:74503157-74503179 GTGAAAATGGACTAATACATAGG - Intergenic
1098774421 12:74593802-74593824 GAGAAGACACAAAAATGCATAGG + Intergenic
1098902574 12:76127944-76127966 TTGAAACAACTCAAATACATAGG + Intergenic
1098965086 12:76779273-76779295 GTGAGAACAGACTAATACAAAGG - Intronic
1099276007 12:80577163-80577185 GTGAGAACAGACTAATACAAAGG - Intronic
1099289431 12:80757730-80757752 CTGATAACACAGAAATACAAAGG + Intergenic
1099295283 12:80822024-80822046 GTGAAAACGGACTAATACTTTGG - Intronic
1099500692 12:83410648-83410670 ATGAAAACAGACTAATACAGTGG - Intergenic
1099507938 12:83501334-83501356 ATGAAAACAAACTAATACATTGG + Intergenic
1099587580 12:84540359-84540381 GAGAAAACACTCAAGGACATTGG - Intergenic
1099700231 12:86074279-86074301 GTGAAAACGAACTAATACATGGG + Intronic
1099889453 12:88573309-88573331 GGGAAAACACACAGATTCTTTGG - Intronic
1099904975 12:88761054-88761076 GTGAGAACAGACTAATACAGTGG - Intergenic
1100285794 12:93165210-93165232 GTGAGAACAGACTAATACACTGG - Intergenic
1100370298 12:93963161-93963183 ATGAACACCCAAAAATACATGGG - Intergenic
1100711152 12:97258292-97258314 TTGCACACACACAAGTACATTGG + Intergenic
1100883045 12:99039501-99039523 ATGAACCCACACAAATACAAGGG + Intronic
1100908169 12:99325831-99325853 ATGAAAACAGACTAATACACTGG - Intronic
1101084271 12:101219618-101219640 TTGAAAACACACCAAAATATGGG - Intergenic
1101207972 12:102507782-102507804 ATGAAAACAGACTAATACGTAGG + Intergenic
1101740913 12:107499492-107499514 GTGAAAACAGACGAATACACAGG - Intronic
1102017670 12:109658446-109658468 GTGCACACACACACATACGTCGG + Intergenic
1102089766 12:110176096-110176118 GAGGAAACACACAGAGACATAGG - Intronic
1102449866 12:113033382-113033404 GTGAAAACAGACAAATACACTGG + Intergenic
1102600175 12:114023713-114023735 GTGAGAACAGACTAATACAGTGG + Intergenic
1102615651 12:114151898-114151920 ATGAAAACAGACTAATACAATGG + Intergenic
1102764874 12:115423643-115423665 AAGAAAACAAACAAAAACATAGG - Intergenic
1102824498 12:115936689-115936711 ATGAAAACAGACTAATACAGGGG - Intergenic
1103230581 12:119327117-119327139 GTGAAAACTGACTAATACACCGG + Intergenic
1103979945 12:124730519-124730541 GTGAAATCACATAACTACACTGG - Intergenic
1104194372 12:126518819-126518841 GTGCACACAAACACATACATAGG - Intergenic
1104532923 12:129589427-129589449 ATGAAAACAGACTAATACATGGG + Intronic
1104656944 12:130580562-130580584 GTGAGAACAGACTAATACATCGG + Intronic
1104878605 12:132053760-132053782 GTGAAAACACACAATTCCTCTGG - Intronic
1105219791 13:18314808-18314830 GTGAGAACTGACTAATACATAGG + Intergenic
1105354305 13:19644878-19644900 GAGAAAACAAACAAAAACTTTGG - Intronic
1105603159 13:21905214-21905236 GAGAAAACCCACACAGACATGGG + Intergenic
1106072799 13:26429365-26429387 GTGATACCACAGAAATACAAAGG + Intergenic
1106268319 13:28129790-28129812 GAGAAAACCCACATAAACATGGG + Intergenic
1106507289 13:30382332-30382354 TTAAAAACACACATATAAATAGG + Intergenic
1106619066 13:31356418-31356440 GTGAAAACAGACTAATACAAGGG + Intergenic
1106937598 13:34740113-34740135 ATGAAAACAGACTAATACAGAGG - Intergenic
1107042475 13:35963940-35963962 GTGAAAACAGACTAATACAATGG + Intronic
1107153731 13:37142083-37142105 GTGAGAACAGACTAATACATAGG + Intergenic
1107369971 13:39734921-39734943 GTGGAAACAAACAAAAAAATAGG - Intronic
1107450187 13:40501230-40501252 GTGAGAACAGACTAATACAATGG + Intergenic
1107569770 13:41644490-41644512 GAGAAAACACACACAGGCATGGG - Intronic
1107690086 13:42945058-42945080 GTGAGAACAGACTAATACGTAGG - Intronic
1107696826 13:43008451-43008473 TTGAAGATACACAGATACATGGG - Intergenic
1107790712 13:43999269-43999291 GTGATAACAGACTAATACAATGG + Intergenic
1108347203 13:49558118-49558140 GAGAAAACCCACACAGACATGGG - Intronic
1108686394 13:52822768-52822790 GTGCCAACACAAAAATAAATGGG + Intergenic
1108980495 13:56506888-56506910 GTGTAAACAGACTAATACAATGG - Intergenic
1109034798 13:57242369-57242391 ATGAAAACAAACTAATACAGTGG + Intergenic
1109189839 13:59310768-59310790 GAGAAAACCCATAAAGACATGGG + Intergenic
1109207284 13:59496656-59496678 CAGACAACACACAAATAAATGGG + Intergenic
1109342402 13:61077433-61077455 GTGAGAACAGACTAATACACAGG + Intergenic
1109626357 13:64980025-64980047 GTGAAAGCAAACAAATTCAAAGG - Intergenic
1109870033 13:68322088-68322110 GTGAGAACAGACAAATACAGTGG - Intergenic
1110025540 13:70534017-70534039 GTGTAAACTCACTAATATATGGG - Intergenic
1110085594 13:71375077-71375099 GTGAAAAAACACCAGTCCATGGG - Intergenic
1110178298 13:72584543-72584565 ATGAAAACAGACTAATACAGTGG - Intergenic
1110550042 13:76801787-76801809 GTGTATACACACAAATGTATTGG + Intergenic
1110645404 13:77877660-77877682 CTGAGAACAGACTAATACATAGG + Intergenic
1111447563 13:88368930-88368952 CTTAAAATACACAAATACTTAGG - Intergenic
1111464696 13:88593745-88593767 GTGAAAACAGACTAATACACAGG - Intergenic
1111475310 13:88738319-88738341 GTGAAAACAGACTAATACGCAGG + Intergenic
1111654025 13:91130336-91130358 ATGAAAACAGACTAATACACAGG - Intergenic
1111785320 13:92779023-92779045 ATGAAAACAGACTAATACAGAGG - Intronic
1112147068 13:96711532-96711554 GTGAAGACAGACAAAGACGTGGG - Intronic
1112284548 13:98092898-98092920 ATGAAAACAGACTAATACAGGGG - Intergenic
1112877377 13:104060761-104060783 ATGAAACCACTCAAAAACATAGG + Intergenic
1113086580 13:106574993-106575015 ATGAAAACAGACTAATACAGGGG + Intergenic
1113136802 13:107099808-107099830 GTAAAAACACATAAATGCAGAGG - Intergenic
1113358658 13:109607788-109607810 GTAAAACCAGATAAATACATAGG - Intergenic
1113359702 13:109619002-109619024 GTGAGAACAGACTAATACAGTGG - Intergenic
1113547972 13:111169231-111169253 GTGAGAACAGACTAATACAGTGG - Intronic
1113827348 13:113267124-113267146 GTGGAAAAACACAAATAAAGGGG - Intergenic
1113846502 13:113394515-113394537 GGGAAAACACACCTACACATCGG + Intergenic
1115254819 14:31388522-31388544 ATGAGCACACACAAATACAATGG + Intronic
1115681439 14:35743101-35743123 GAGAAAACCCACATAGACATGGG + Intronic
1115931977 14:38507728-38507750 ATGAAAACAAACTAATACAGTGG - Intergenic
1116072254 14:40062873-40062895 GTAAAAACACTCAAAAACTTGGG - Intergenic
1116199137 14:41769477-41769499 ATAAATACACACACATACATAGG - Intronic
1116607802 14:47025043-47025065 GTTAAAAAACAAAAATATATTGG + Intronic
1116759725 14:48996877-48996899 GTGAAAATTCACAAAGAAATTGG - Intergenic
1116762254 14:49028168-49028190 ATGAAAACAGACTAATACATGGG + Intergenic
1116838780 14:49797908-49797930 GTGAAAACCCACAAAGACATGGG - Intronic
1117561287 14:56941967-56941989 ATGAAAACACACGGACACATAGG - Intergenic
1117862227 14:60104509-60104531 GTGAAAACAGATGAATACAGAGG - Intronic
1118255651 14:64203031-64203053 GTGAAAACACATAGATATACGGG - Intronic
1118260599 14:64243224-64243246 GTCAGAACACACAAATTTATAGG + Intronic
1118698172 14:68405670-68405692 CAGAAAACAACCAAATACATGGG + Intronic
1118908448 14:70041171-70041193 ATGAAAACCCACATAGACATAGG + Intergenic
1118927401 14:70205299-70205321 GTGAAAATGGACTAATACATTGG + Intergenic
1118941260 14:70340396-70340418 GTGAAAACAGACTAATACACTGG + Intronic
1119316203 14:73697263-73697285 GTAAAATCACACAAGTAGATGGG - Exonic
1120156756 14:81101796-81101818 GAGAAAACCCACACAGACATGGG + Intronic
1120208712 14:81613264-81613286 GTGAAAACGGACTAATACAAGGG - Intergenic
1120352946 14:83386563-83386585 GTGAAAACAGACCAATACAATGG - Intergenic
1120383625 14:83815589-83815611 GTGAAAATAAAAAAATTCATTGG + Intergenic
1120413447 14:84188426-84188448 GTAAAAATACAGAAATATATTGG + Intergenic
1120920898 14:89754751-89754773 GTGAAAATGGACTAATACATGGG - Intergenic
1120933623 14:89873016-89873038 GTGAGAACAGACTAATACAGTGG - Intronic
1121043275 14:90768187-90768209 GTGAAAATGGACTAATACATTGG - Intronic
1121256877 14:92537528-92537550 TTGCAAACACATAAACACATAGG - Intronic
1121936754 14:98026996-98027018 ATGAAAACAGACTAATACAATGG - Intergenic
1122039724 14:98976829-98976851 GTGTAAACCCACAGATACACAGG + Intergenic
1122377871 14:101278658-101278680 GTGAGAACAGACTAATACAGTGG - Intergenic
1122656389 14:103263305-103263327 ATGAACACACAGAAATACAAAGG - Intergenic
1123188275 14:106540946-106540968 ATGAAAACACACATATATATTGG + Intergenic
1124062291 15:26305598-26305620 GTGAGAACATACTAATACAGAGG - Intergenic
1124557407 15:30739316-30739338 GTGACACCACAGAAATACAAAGG + Intronic
1124673849 15:31666434-31666456 GTGACACCACAGAAATACAAAGG - Intronic
1124732211 15:32208657-32208679 GTAAAAATACACAAATTAATCGG + Intergenic
1124992541 15:34690149-34690171 GTGAGAACAGACTAATACAGTGG + Intergenic
1125088613 15:35763152-35763174 GACAAAACACACAACTACTTGGG - Intergenic
1125169671 15:36751946-36751968 ATGAAAACACATAGACACATGGG + Intronic
1125270024 15:37928766-37928788 GTGAAAACAGACTAATACACTGG - Intronic
1125393875 15:39226183-39226205 GAGAAAAAACAAAAATACCTAGG - Intergenic
1126365300 15:47887942-47887964 GTGAAAATGGACTAATACATTGG - Intergenic
1126463297 15:48936708-48936730 GTGAGAACAGACTAATACACTGG + Intronic
1126533021 15:49731723-49731745 GTGAGAACAGACCAATACAGTGG - Intergenic
1126667760 15:51090559-51090581 GAGAAAAGACACAAATAAACAGG - Intronic
1126942245 15:53779939-53779961 ATGAAAACAAACTAATACAAAGG + Intergenic
1127375337 15:58379270-58379292 TTTAAAAGACACAAATAAATGGG + Intronic
1127916152 15:63457488-63457510 GTTAAAACACTGAAATACTTCGG + Intergenic
1128119753 15:65136925-65136947 ATGAAAACAGACTAATACAGAGG - Intergenic
1128826873 15:70726781-70726803 GTGATAAATCACAAATAAATTGG - Intronic
1130015799 15:80185499-80185521 GTGAAAACAGACTAATACAGTGG - Intronic
1130051981 15:80491171-80491193 GTGAAAACTAACTAATACAATGG - Intronic
1130346473 15:83051732-83051754 GTTTAGACACACAAATACTTTGG + Intronic
1131310817 15:91288197-91288219 GTGAGAACACACCTGTACATGGG - Intronic
1131318222 15:91360527-91360549 GTGCATAAACACAAATACAAAGG - Intergenic
1131372743 15:91896760-91896782 GTGAGAACAGACTAATACAGAGG + Intronic
1131452470 15:92555828-92555850 CTGATAACACAAAAATACAAAGG + Intergenic
1131582223 15:93655412-93655434 GTGAGAACAGACTAATACAAGGG + Intergenic
1131669598 15:94605806-94605828 ATGAAAACTCAAAAAGACATAGG - Intergenic
1131752478 15:95525085-95525107 GTGAAAACGGACTAATACAGAGG - Intergenic
1132065259 15:98725680-98725702 ATGAAAACAGACTAATACAGAGG - Intronic
1133365409 16:5205165-5205187 GTGGAAACAGACTAATAAATAGG - Intergenic
1133655989 16:7864547-7864569 GTGAGAACACACAGCTACATAGG + Intergenic
1133693201 16:8235995-8236017 GTGAAAACAGACTAATACAGAGG - Intergenic
1133788542 16:8991458-8991480 CTAAAAACACACAAAAAAATTGG - Intergenic
1133828786 16:9302745-9302767 GAGAAAAGACACAGACACATGGG + Intergenic
1133866210 16:9645985-9646007 TTGAAACCACACATATAAATAGG - Intergenic
1134274053 16:12759886-12759908 GTGAAAACAGACTAATACTGGGG + Intronic
1134569256 16:15277564-15277586 GTGAAAACAGACTAATACATGGG - Intergenic
1134733121 16:16478481-16478503 GTGAAAACAGACTAATACATGGG + Intergenic
1134871982 16:17660337-17660359 GTGCACACACACACATACAGAGG + Intergenic
1134934318 16:18233492-18233514 GTGAAAACAGAGTAATACATGGG - Intergenic
1135781795 16:25309415-25309437 GTGATACCACAGAAATACAAAGG - Intergenic
1135952398 16:26927376-26927398 GTGAGAACAGACTAATACACTGG + Intergenic
1136252174 16:29012509-29012531 GGGAACACACACAGTTACATGGG - Intergenic
1136608320 16:31351501-31351523 GTAAAAATACACAAATACAGAGG - Intergenic
1137638725 16:50009884-50009906 GTGAGAACAGACTAATACACAGG + Intergenic
1138383993 16:56623490-56623512 GTGAAAACAAACTAATACAATGG + Intergenic
1138675958 16:58651290-58651312 GTGAAAACAAAAATAAACATCGG - Intergenic
1138697661 16:58830475-58830497 GTGAAAACAGATGAATACAGGGG + Intergenic
1138732631 16:59211828-59211850 GGTAAAACACACAAAAAGATTGG + Intergenic
1138745786 16:59362093-59362115 GTGAGAACAGACTAATACAAGGG + Intergenic
1139501417 16:67369561-67369583 GTGAGAACAGACTAATACAAGGG - Intronic
1140296333 16:73712755-73712777 GTGAAAACAAAGAAATACCTAGG - Intergenic
1140763151 16:78130209-78130231 ATGAAAACAGACTAATACAGGGG + Intronic
1140870073 16:79098165-79098187 TTGAAAACACACAGATGCCTGGG + Intronic
1140899541 16:79355158-79355180 GTGAAAACTCCAGAATACATTGG + Intergenic
1141291324 16:82720606-82720628 GGGAAAACCCACACAAACATGGG + Intronic
1141780784 16:86159257-86159279 GTGAAGACACACAGACACAATGG + Intergenic
1142361293 16:89628584-89628606 GTGAAAATGGACAAATACAGTGG + Intronic
1145822865 17:27853190-27853212 ATGGATACACACAAAAACATGGG - Intronic
1145857574 17:28176860-28176882 TTAAAAACACACAAATACAATGG + Intronic
1146583155 17:34057983-34058005 GTGCACGCACACAAGTACATGGG - Intronic
1146866569 17:36340367-36340389 GTAAAAATACTCAAATACAAAGG - Intronic
1146999079 17:37347369-37347391 GTGAAAACAGACTAATACAAGGG + Intronic
1147069438 17:37940971-37940993 GTAAAAATACTCAAATACAAAGG - Intergenic
1147080967 17:38020511-38020533 GTAAAAATACTCAAATACAAAGG - Intronic
1147096909 17:38144468-38144490 GTAAAAATACTCAAATACAAAGG - Intergenic
1147547737 17:41415951-41415973 ATGAAAAGACACAACTATATGGG - Intergenic
1147681639 17:42251701-42251723 ATGAAAATATACAAATAGATTGG + Intronic
1147857582 17:43493985-43494007 GTGAAAACAGACTAATACAGTGG - Intronic
1148707954 17:49652445-49652467 TTCAAACCACACAAAGACATTGG - Intronic
1149109893 17:53015996-53016018 ATGCACACACACATATACATAGG - Intergenic
1149466664 17:56885437-56885459 GTGAAAACGGACTAATACAATGG - Intergenic
1149889964 17:60380013-60380035 GTAAAAATACTCAAATACAAAGG + Intronic
1149955378 17:61043549-61043571 CTGAAAACCCACACAGACATGGG - Intronic
1150286715 17:63958894-63958916 GTGAAAAGACAGAAATTCAGAGG + Intronic
1150323713 17:64238447-64238469 ATGAGAACAGACTAATACATTGG - Intronic
1150508666 17:65725602-65725624 ATGAAAACAGACTAATACAGTGG - Intronic
1151122236 17:71806039-71806061 GTGTACACACACACACACATTGG - Intergenic
1151243125 17:72773612-72773634 TTGAAAACAGACTAATACAGGGG + Intronic
1151269116 17:72979347-72979369 CTGAAAACAGACTAATACAGGGG + Intronic
1152201534 17:78949769-78949791 CTAAAAATACAAAAATACATGGG + Intergenic
1152292500 17:79448166-79448188 GTGAGAACAGACTAATACAATGG + Intronic
1152326814 17:79646355-79646377 GTGAGAACAGACTAATACAATGG - Intergenic
1152784933 17:82242706-82242728 GTTAAAGTACACAAATACAGTGG + Exonic
1152791287 17:82281511-82281533 ATGAACACACACACATACACGGG - Intergenic
1152940271 17:83167518-83167540 GAGAAAACCCACACAGACATGGG - Intergenic
1152978720 18:251623-251645 GAGAAAACCCACACAGACATAGG - Intronic
1153172189 18:2328834-2328856 GTGGAAACTGACAAAGACATCGG - Intergenic
1154509066 18:15075623-15075645 ATGAAAATAGACAAATACAGGGG + Intergenic
1155043295 18:22082855-22082877 ATAAAAACAAACAAATAAATAGG - Intergenic
1155128206 18:22901715-22901737 GTGGACACACACACATACAGGGG + Intronic
1155192133 18:23439326-23439348 GTGAAAACAGACTAGTACACTGG + Intergenic
1155504306 18:26517850-26517872 GTGAAAACAGACTAACACAGCGG + Intronic
1155639858 18:28000107-28000129 GTGAGAACAGACTAATACAGAGG + Intronic
1155777686 18:29788821-29788843 GTGAAGACAAATAAATACTTTGG + Intergenic
1156024649 18:32638151-32638173 GTGAAAACAGACTAATACAATGG + Intergenic
1156196359 18:34778066-34778088 GTAAAACCTCACAAATCCATAGG - Intronic
1156467730 18:37358473-37358495 GTGAAAACGGACTAATACAGAGG + Intronic
1156657015 18:39300407-39300429 GTGCACACACAAACATACATGGG - Intergenic
1157243919 18:46037071-46037093 GCAAACACACACAAATACAGGGG - Intronic
1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG + Intergenic
1158867693 18:61653865-61653887 GAGAAAACACACAAATTAACAGG - Intergenic
1158902993 18:61983847-61983869 GTGAAAACAGACGAATACAGGGG - Intergenic
1158969714 18:62655267-62655289 GAGAAAACCCACACAGACATGGG - Intergenic
1159345360 18:67195293-67195315 GTGAAAACAGACTAATACAGTGG + Intergenic
1159454681 18:68645355-68645377 GTGATAACAGACTAATACACTGG + Intergenic
1159697202 18:71575093-71575115 GTGAAAACAGAATAATACACAGG - Intergenic
1159727770 18:71983823-71983845 GTGTATACACACAAACACACAGG - Intergenic
1159872352 18:73772700-73772722 GTTAATATACATAAATACATGGG - Intergenic
1160284368 18:77526459-77526481 ATGAAAACAGACTAATACACTGG + Intergenic
1162847929 19:13408156-13408178 GTGAGAACAAACGAATACACTGG + Intronic
1163053590 19:14702700-14702722 GTGAGAACAGACTAAGACATGGG - Intronic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1164387754 19:27790662-27790684 GTGAAAACACTCAAAAAAGTAGG + Intergenic
1164404237 19:27928500-27928522 GTGAATACATGCAGATACATGGG + Intergenic
1164569007 19:29355319-29355341 GTGAAAAAGGACTAATACATGGG + Intergenic
1164924478 19:32118258-32118280 CAGAAAATTCACAAATACATGGG - Intergenic
1166972292 19:46577293-46577315 GTGAAAACAGACAAATACACTGG + Intronic
1167750104 19:51374274-51374296 GTGAGAATAGACTAATACATAGG + Intergenic
1167847151 19:52173952-52173974 GTGAGAACAAACTAATACACTGG + Intergenic
925455911 2:4016517-4016539 GTGAGAACAGACTAATACAGTGG - Intergenic
925648318 2:6061282-6061304 GTGAAGACACTGAGATACATGGG + Intergenic
925660257 2:6194721-6194743 GTGAAAACAGACTAATACACAGG + Intergenic
925801162 2:7602081-7602103 GAGAAAACACACAAAATAATGGG - Intergenic
925812683 2:7716555-7716577 AAGAAAACACACACATATATAGG - Intergenic
925952129 2:8924809-8924831 GCTAAAATACACAAATAAATTGG + Intronic
925981823 2:9183315-9183337 GTGAAAACGGACTAATACAATGG + Intergenic
926663952 2:15499249-15499271 GTGAGAACAGACTAATACACTGG + Intronic
926838209 2:17048204-17048226 GTGAAAAGAGAGAAATATATGGG - Intergenic
926870650 2:17411855-17411877 ATGAAAACAGACTAATACAGAGG + Intergenic
927130583 2:20055293-20055315 GTGAAAATGGACGAATACATGGG - Intergenic
927131398 2:20063526-20063548 GTGATAACAAACTAATACAGAGG + Intergenic
927768130 2:25832528-25832550 GTGTAAACACACAAATTAAAAGG + Intronic
928368915 2:30724678-30724700 GTGAAAACACTCAACACCATTGG - Intronic
928432467 2:31232429-31232451 GTGAAAACAGACGAATACAGAGG - Intronic
928464837 2:31514061-31514083 GTGAGAACAGACTAATACAGAGG - Intergenic
928706077 2:33951266-33951288 ATGAAAACAGACTAATACACTGG - Intergenic
928899375 2:36301075-36301097 GTGAAAACGGACTAATACAGTGG - Intergenic
929256394 2:39815675-39815697 ATGAAAACACATGAACACATGGG + Intergenic
929434186 2:41914776-41914798 GTGAAAACGGACTAATACAGAGG + Intergenic
929851227 2:45592250-45592272 ATGAAAACAGACTAATACATAGG + Intronic
929999909 2:46854308-46854330 GTGAAAACGGACTAATACAGTGG + Intronic
930140436 2:47946188-47946210 GAGAAAACCCACACAGACATGGG + Intergenic
930174497 2:48288050-48288072 ATGAAAACAAACTAATACAATGG - Intergenic
930291935 2:49505432-49505454 GAGAAAACCCACACAGACATGGG - Intergenic
930343000 2:50141371-50141393 GGGAAAACACTCTAAGACATTGG + Intronic
930766648 2:55091689-55091711 ATGAAAACAGACTAATACACTGG - Intronic
930862037 2:56084535-56084557 GTGGAAGCACACAAGCACATAGG - Intergenic
930937462 2:56971168-56971190 GTGAAAACACTGAAATGCAGAGG + Intergenic
931238891 2:60435157-60435179 GATAAAACACATAAATAAATTGG + Intergenic
931294231 2:60905920-60905942 GTGAAAACGGACTAATACATAGG - Intronic
931501772 2:62876543-62876565 GTGAGAACAGACTAATACAATGG - Intronic
931684697 2:64783603-64783625 GTGACAAAACACAACTACATGGG + Intergenic
931793120 2:65683075-65683097 ATGAAAACAGACAAATACACTGG + Intergenic
931861111 2:66355655-66355677 GTGAAAACAGACTAATACACTGG - Intergenic
931928489 2:67101631-67101653 CTGAAGACACACACATATATAGG - Intergenic
932019964 2:68074393-68074415 ATGAAAACAGACTAATACAATGG + Intronic
932104607 2:68931294-68931316 GTGAAAACAAACTAATACACAGG - Intergenic
932110979 2:68999833-68999855 ATGAGAACACACAGACACATGGG - Intergenic
932640788 2:73443874-73443896 GTGATAAGACACTAATCCATAGG - Intronic
932651982 2:73567574-73567596 GTGAAAATACTTAAATACAGTGG + Intronic
932654187 2:73594414-73594436 GAAAAAACACACAATTACACTGG - Intronic
932682944 2:73842279-73842301 GAGAAAACCCACACAGACATGGG - Intronic
933316672 2:80723606-80723628 GTGAAACCACTCCAAAACATGGG + Intergenic
933558301 2:83859510-83859532 ATGCAAACACACACACACATAGG - Intergenic
933585412 2:84174879-84174901 GTGAGAACAGACTAATACACAGG - Intergenic
934117112 2:88808652-88808674 CTGAGAACACAAACATACATGGG + Intergenic
934184256 2:89657709-89657731 GTGAGAACTGACTAATACATAGG - Intergenic
934294545 2:91731847-91731869 GTGAGAACTGACTAATACATAGG - Intergenic
934967232 2:98732982-98733004 ATGAAAACGGACGAATACATTGG + Intergenic
935094198 2:99928176-99928198 GTGAAAACAGACTTATACAGAGG + Intronic
935327219 2:101948015-101948037 GTGAGAACAAACTAATACACTGG - Intergenic
935424432 2:102905122-102905144 GAGAAAACCCACACAGACATGGG + Intergenic
936004411 2:108869955-108869977 GTAAAGACACACAAATTAATTGG + Intronic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
936160550 2:110081295-110081317 CTGAGAACACAAACATACATAGG + Intergenic
936184114 2:110290059-110290081 CTGAGAACACAAACATACATAGG - Intergenic
936429564 2:112450493-112450515 ATGAGAACAGACTAATACATTGG + Intergenic
936549955 2:113428369-113428391 GTGAAAACAGACTAATACAGTGG + Intergenic
936586563 2:113763442-113763464 ATGAAAACAGACTAATACCTTGG - Intergenic
936901892 2:117490469-117490491 GTGAGAAGACACAAATGCAGAGG + Intergenic
936910377 2:117585005-117585027 CTGACAACACAGAAATACAAAGG + Intergenic
937590852 2:123611507-123611529 ATGAAAACACAAAGATACAGAGG - Intergenic
938165534 2:129022359-129022381 ATGAAAACAGACTAATACATGGG + Intergenic
938234763 2:129696763-129696785 GTGAAAATGGACTAATACATAGG + Intergenic
938585869 2:132690169-132690191 GAGAAAACCCACACAGACATGGG - Intronic
938691394 2:133792727-133792749 CTGAAAACACAAAACTAGATGGG + Intergenic
938978551 2:136503837-136503859 GAGAAAACTCACACAGACATGGG - Intergenic
939073202 2:137568471-137568493 GTGAAAATAGACTAATACACTGG - Intronic
939253211 2:139710294-139710316 GTGAAAATACTGAAATACAGTGG - Intergenic
939335766 2:140826311-140826333 GAGAAAACCCACACAGACATGGG - Intronic
939803781 2:146747907-146747929 GTGAAAACAGACTAATACAGAGG - Intergenic
940136658 2:150444689-150444711 GTGAATACTCAGACATACATAGG - Intergenic
940322076 2:152388242-152388264 GTGAGAACAGACCAATACAATGG - Intronic
940359818 2:152785698-152785720 GTGAAAGCAAACTAATACAGGGG - Intergenic
940447678 2:153795952-153795974 GTGAAAACACGCAAGAACAGAGG - Intergenic
940711920 2:157172889-157172911 TTCAAAACACACATGTACATTGG + Intergenic
940762236 2:157750829-157750851 TTAAAAATACACAAATAAATTGG + Intronic
940812619 2:158262496-158262518 GTGAAAACAGACTAATACAGGGG - Intronic
941184964 2:162310456-162310478 TTAAATATACACAAATACATTGG - Intronic
941364647 2:164595381-164595403 ATGAAAACAAACAAACACAATGG + Intronic
941386407 2:164858087-164858109 GTGAAAACAGACTAATACAGTGG - Intergenic
941862333 2:170296653-170296675 GTGAGAACAGACTAATACAGAGG - Intronic
942949112 2:181702730-181702752 GTGAAAACAGGCTAATACATAGG - Intergenic
943081047 2:183259567-183259589 GTGAAAACAGACTAATACAAGGG + Intergenic
943138032 2:183940445-183940467 TTGAAAATGCACAAATACATGGG + Intergenic
943463335 2:188197417-188197439 GTGAAAACAAACTAATATAGTGG - Intergenic
943552701 2:189359883-189359905 CTGATAACACAGAAATACAAGGG - Intergenic
943874749 2:193051003-193051025 GAGTAAACACACATAGACATGGG + Intergenic
944252187 2:197589433-197589455 GTGAAAACGGACTAATACAGTGG + Intronic
944303573 2:198153947-198153969 GTCAAAACATCCAAATTCATGGG + Intronic
944877965 2:203982183-203982205 GTGAAAACGGACTAATACAGTGG - Intergenic
944957606 2:204830222-204830244 GTGAGAATGCACTAATACATAGG + Intronic
945077735 2:206056945-206056967 TTTAAAATACACACATACATGGG + Intronic
945174330 2:207026947-207026969 CTGATAACACAGAAATACAAAGG + Intergenic
945665546 2:212736852-212736874 GTCAAAATAAACAAATAAATTGG + Intergenic
945669125 2:212781028-212781050 GTGAAAACGGACTAATACACAGG + Intergenic
946055450 2:216897229-216897251 AAAAAAACAGACAAATACATAGG - Intergenic
946079187 2:217102384-217102406 GTGAAAACAGACTAATACATAGG + Intergenic
946879037 2:224159330-224159352 GTGAGAACAGACTTATACATGGG - Intergenic
946906872 2:224425948-224425970 ATGAAAACAGACTAATACATTGG + Intergenic
947049607 2:226027465-226027487 GTGAGAACAGACTAATACATGGG - Intergenic
947093572 2:226541355-226541377 ATGAGAACAGACTAATACATGGG - Intergenic
947135228 2:226970743-226970765 ATGAAAACAAACAAAAACAATGG - Intronic
947180456 2:227406771-227406793 GAGAAAAGAAACAAATAGATGGG - Intergenic
947207350 2:227673975-227673997 GTGAGAACAAACTAATACAATGG + Intergenic
947248250 2:228074293-228074315 GTGAAAACAGACTAATACGTGGG - Intronic
947294982 2:228621045-228621067 GTGAAAATTCAGCAATACATGGG - Intergenic
947345458 2:229185418-229185440 ATGAAAACAGACTAATACAGGGG - Intronic
947431782 2:230035364-230035386 GTGCAAGCATTCAAATACATTGG + Exonic
948565318 2:238882656-238882678 GTAAAAACACTTAAATTCATGGG + Intronic
948726272 2:239935925-239935947 GTGAAAACAGACTAACACACAGG + Intronic
1169705604 20:8500935-8500957 CTGAAACCACACAAGTACACTGG + Intronic
1169766581 20:9153618-9153640 ATGAAAACAAACTAATACAATGG + Intronic
1170313980 20:15023485-15023507 GTGAGAACAGACTAATACCTTGG - Intronic
1170331223 20:15213067-15213089 GTGAGAACACACAACAACAAGGG + Intronic
1170480177 20:16757417-16757439 GTGAGAACAGACTAATACAAAGG - Intronic
1171950796 20:31419887-31419909 GTGAGAACAGATAAATGCATGGG + Intergenic
1172792558 20:37515925-37515947 AGAAAAACACACAATTACATTGG - Intronic
1172805634 20:37609720-37609742 GTGAAAACAGACTAATACAGTGG - Intergenic
1172813097 20:37664650-37664672 ATGAAAACAGACTAATACAATGG - Intergenic
1173432546 20:43002292-43002314 GTGAAAACGAACTAATACAAGGG + Intronic
1173542974 20:43868521-43868543 GTGAGAACAGACTAATACATAGG + Intergenic
1173943661 20:46933093-46933115 GTGAGAACAGACTAATACAAGGG + Intronic
1173969660 20:47142514-47142536 ATAAAAACACACAAACACAAAGG - Intronic
1174089466 20:48035517-48035539 GTGAGAACGAACTAATACATGGG + Intergenic
1174181645 20:48678852-48678874 ATGAAAACAGACTAATACAGAGG + Intronic
1174668508 20:52283338-52283360 GTGAAAATGGACTAATACATAGG + Intergenic
1174685765 20:52453380-52453402 GTGAAAACGGACTAATACACTGG + Intergenic
1174750210 20:53104523-53104545 GAAAAAACACACAAAGACTTTGG - Intronic
1174922316 20:54717195-54717217 ATGAAAACTCACCAATACACTGG - Intergenic
1175013439 20:55763682-55763704 GTGAAAATAGACTAATACAAAGG - Intergenic
1175594391 20:60219156-60219178 GTAAAAACACACACATACACCGG - Intergenic
1175635138 20:60575588-60575610 GTGAGAACAAACTAACACATGGG + Intergenic
1175693890 20:61086694-61086716 GTGAGAACAGACAAATACACTGG - Intergenic
1176660639 21:9632161-9632183 GCAAAAACACACAAATAAAATGG - Intergenic
1176874320 21:14113692-14113714 GTGAGAACAGACTAATACAGTGG - Intronic
1177319422 21:19500944-19500966 GAGAGAACAGACTAATACATTGG - Intergenic
1177380283 21:20331625-20331647 GGTAAAACACAAAAATACTTTGG + Intergenic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1177593146 21:23200223-23200245 GTGGAAACATAAAATTACATGGG - Intergenic
1177628918 21:23701430-23701452 ATGAAAACAAACTAATGCATTGG + Intergenic
1177660701 21:24079526-24079548 CTGATACCACAGAAATACATAGG + Intergenic
1177910962 21:27031268-27031290 GAGAAAACCCACACAGACATGGG + Intergenic
1177971309 21:27793423-27793445 ATGAGAACACACAGACACATGGG + Intergenic
1178379698 21:32097447-32097469 GTGAAAACAGACTAACACACAGG - Intergenic
1178472908 21:32910150-32910172 ATGAAAACAGACTAATACAGGGG - Intergenic
1178503179 21:33142374-33142396 ATGAAAACACACTAATAAAGAGG + Intergenic
1178536689 21:33415823-33415845 GTGCACACACACACACACATTGG - Intronic
1179294172 21:40045825-40045847 ATGAAAGCACATAAATAAATCGG - Intronic
1179406964 21:41134419-41134441 GTGAAAACAAACAAAAAAATGGG - Intergenic
1179563645 21:42233081-42233103 GTGAAAAAACGCAAAAAGATGGG + Intronic
1180008841 21:45036176-45036198 GAGAAAATAGACAAATACATGGG + Intergenic
1180115293 21:45699543-45699565 GTGAGAACAGACTAATACACTGG - Intronic
1180168239 21:46041136-46041158 GTGAGAACAGACAAATACACAGG + Intergenic
1180817397 22:18799699-18799721 GTGAGAACTGACTAATACATAGG + Intergenic
1181028013 22:20136814-20136836 GTGCACACACACAAATATACAGG - Intronic
1181203587 22:21234020-21234042 GTGAGAACTGACTAATACATAGG + Intergenic
1181776398 22:25162971-25162993 GTGAAAACAAACACATAAATGGG - Intronic
1181871953 22:25906615-25906637 GTGAAAACAGACTAATACAATGG - Intronic
1183156176 22:36077067-36077089 GTGAAAACAGACTAATACAGTGG + Intergenic
1183675424 22:39296586-39296608 GTGCAAAGACACAAATCCAGTGG - Intergenic
1184439469 22:44500033-44500055 GTGAAAACAGACTAATACACTGG + Intergenic
1184982118 22:48102162-48102184 GTGAAAACAGACTAATACAGAGG - Intergenic
1184992311 22:48179002-48179024 GGGAAAGCCCACAGATACATAGG - Intergenic
1203223334 22_KI270731v1_random:61394-61416 GTGAGAACTGACTAATACATAGG - Intergenic
1203267495 22_KI270734v1_random:25426-25448 GTGAGAACTGACTAATACATAGG + Intergenic
949197547 3:1331076-1331098 GTGAAAACAAACAAAAGCAGGGG + Intronic
949240029 3:1859827-1859849 GTGAAAACGAACTGATACATAGG + Intergenic
949662599 3:6296720-6296742 ATGATAATACACAAATACTTTGG + Intergenic
949784226 3:7723090-7723112 GTTTAAAGACAAAAATACATAGG - Intronic
949871728 3:8595044-8595066 GTGAGAACAGACTAATACACAGG + Intergenic
949913388 3:8935260-8935282 ATTAAACCACACACATACATTGG - Intronic
950120472 3:10479137-10479159 GTGGAAACAGACTAATACACTGG + Intronic
951354237 3:21644509-21644531 GAGAAAACACACGCAGACATGGG + Intronic
951404760 3:22282062-22282084 CTGATAACACAGAAATACAAGGG - Intronic
951425804 3:22543667-22543689 GTGAAAACAGACTAATACAATGG + Intergenic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
951737914 3:25887949-25887971 GTGAGAACAGACTAATACAATGG - Intergenic
951801575 3:26602669-26602691 ATGAAAACAGACTAATACAGTGG - Intergenic
952086319 3:29825727-29825749 GTGAGAACAGACTAATACACTGG + Intronic
952202515 3:31146453-31146475 GTGAAAACAGACTAAGACACAGG - Intergenic
952315157 3:32226027-32226049 GTGAAAACGGACTAATACACAGG - Intergenic
953181052 3:40595701-40595723 GTGAAAACAGACTAATACATTGG + Intergenic
953295848 3:41715600-41715622 GTTAAAAACCACAAATACTTAGG + Intronic
954502056 3:51027238-51027260 TCAAAACCACACAAATACATGGG - Intronic
955236737 3:57146073-57146095 GTGCACACACACACATACAAAGG + Intronic
955841368 3:63116513-63116535 GTGAAAACAGACTAATACAAGGG - Intergenic
955914559 3:63893710-63893732 GTGAAAACACACAAGTGGAGAGG - Intronic
955945973 3:64193957-64193979 GTGAAAACAGACTAATGCACAGG + Intronic
956723024 3:72134935-72134957 GTGCACACACACACATACACAGG + Intergenic
956864376 3:73355142-73355164 CTGCAAACAGAAAAATACATAGG - Intergenic
956890664 3:73610595-73610617 GTGAAAAGTTAGAAATACATGGG + Intronic
957120598 3:76086057-76086079 GTGAGATCAGACTAATACATAGG - Intronic
957182601 3:76899932-76899954 GTGAAAACAGACTAATACAGAGG - Intronic
957410966 3:79839700-79839722 GTGAAAACAGACTAATACAATGG - Intergenic
957557310 3:81779407-81779429 GTGAGAACAGACTAATACAGTGG - Intergenic
957667142 3:83247514-83247536 GTGCAAAGACACACATACAAAGG - Intergenic
957730676 3:84130044-84130066 GTCAAAACAGACTAATACAGAGG - Intergenic
957866175 3:86026529-86026551 TTGAAAACAAACAAAATCATTGG - Intronic
957882807 3:86243193-86243215 GTATAAACACACAAATGTATAGG + Intergenic
958066107 3:88546080-88546102 GTGAAAACGGACTAATACAGTGG + Intergenic
958141984 3:89572851-89572873 GTGAAGACAAACATATAAATTGG + Intergenic
958146685 3:89632677-89632699 GTGAAAGCAAACTAATACAGTGG + Intergenic
958648116 3:96899267-96899289 ATGAAGACACAGATATACATAGG - Intronic
958842276 3:99221531-99221553 GTGATAACACAGAAATACAAAGG + Intergenic
959123008 3:102255114-102255136 GTGGAAACTCACGAATACAGAGG + Intronic
959190093 3:103100117-103100139 CTGATACCACACAAATACAAAGG - Intergenic
959230377 3:103641844-103641866 GTAAAAAGACAAAAATAAATAGG + Intergenic
959387879 3:105734967-105734989 TTGAAAAAATACAAATAAATTGG + Intronic
959443135 3:106404366-106404388 GTGAAAACAGACTAATGCACTGG - Intergenic
959488736 3:106960606-106960628 GTAAAAACAGACTAATACAATGG - Intergenic
959510253 3:107202827-107202849 GTGAGAACAGACTAATACATTGG - Intergenic
959879762 3:111429790-111429812 GTGAAAACAGACTAATACACTGG - Intronic
960044460 3:113183240-113183262 GTGAAAACCCACACAGACATGGG + Intergenic
960261344 3:115572186-115572208 GTGAAAACAGACTAATACAGGGG - Intergenic
960399594 3:117180180-117180202 GTGAAAACAGACTAATACAATGG - Intergenic
960455875 3:117870885-117870907 GTGAATATGCACAAATACAGTGG + Intergenic
960502348 3:118453429-118453451 GTGAAAACAAACTAATACACTGG + Intergenic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
960892454 3:122463753-122463775 GTGAGATCCCACAAATAAATAGG + Intronic
961195895 3:125001192-125001214 GTGCAAACAAACAAACACAAAGG + Intronic
961853185 3:129841975-129841997 GTGAAAACAAACTAATACAAGGG + Intronic
962544053 3:136413831-136413853 GAAAAAATATACAAATACATAGG + Intronic
962629439 3:137260831-137260853 GAGAAAACCCACACAGACATAGG - Intergenic
962828866 3:139122326-139122348 GGGATAACACACAAGTATATGGG + Intronic
963018063 3:140844674-140844696 GTGAAAACAGACTAATACAAAGG - Intergenic
963568804 3:146965727-146965749 ATGAAAACACACAAAAGCAATGG + Intergenic
963803300 3:149698498-149698520 GTGAGAACAGACTAATACAGTGG + Intronic
964121837 3:153193253-153193275 GTCAAAACACAGACATACATTGG + Intergenic
964295500 3:155228563-155228585 GTGTAAACTAACAAATTCATAGG - Intergenic
964316651 3:155452058-155452080 ATGAAAACAGACTAATACATAGG - Intronic
964669401 3:159208901-159208923 GTGAAGACAAAGAAATACATTGG + Intronic
964992106 3:162827401-162827423 ATGAAAACAGACTAATACAGAGG - Intergenic
965204367 3:165702822-165702844 ATGAAAACACTCAAATAAACAGG + Intergenic
966417028 3:179699953-179699975 ATGAACACACACAGAAACATAGG - Intronic
966499584 3:180624591-180624613 GTGAAAACACACAAAAGTACAGG - Intronic
966717118 3:183024087-183024109 CTGAAAACACACAATTACCCGGG + Intronic
966797048 3:183725399-183725421 GTGAAAACAGACTAATACAATGG - Intronic
967154843 3:186682889-186682911 GTGAAAACAGACTAATACATTGG - Intergenic
967528207 3:190518541-190518563 ATGAACACAGACTAATACATAGG - Intronic
967609316 3:191484330-191484352 GTGAAAATGGACTAATACATTGG + Intergenic
968237468 3:197043225-197043247 GGGAAAACACACACATAAATGGG + Exonic
969265758 4:6063169-6063191 GTGTAAAGACACAAATACGAAGG + Intronic
969661858 4:8534890-8534912 GTGAAAACAGACAAATACACAGG - Intergenic
970151663 4:13096668-13096690 GTGAAAACGGACTAATACAGAGG - Intergenic
970202631 4:13625585-13625607 CTGAGAACACACAGATTCATGGG + Intronic
970476163 4:16426335-16426357 GTGAAAACAAACAACAACAATGG - Intergenic
970541946 4:17088907-17088929 ATGAAAACGGACTAATACATTGG + Intergenic
970713265 4:18889436-18889458 GAGAAAACACACACAAACATGGG + Intergenic
970740798 4:19235308-19235330 CTAAAAACACACAAAAAAATTGG + Intergenic
970836826 4:20419246-20419268 ATGAAATCACACATATACAAAGG - Intronic
970856568 4:20655795-20655817 GTGAAAATAGACTAATACAGGGG + Intergenic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
971114574 4:23629824-23629846 GTGAAAATTCACTAATACAGTGG + Intergenic
971232670 4:24812621-24812643 ATGAAAACAGACTAATACAGAGG - Intronic
971274479 4:25182742-25182764 GTGAAAACGGACTAATACAAGGG + Intronic
971279475 4:25230944-25230966 ATGAAAACAGACTAATACACTGG - Intronic
971357585 4:25908975-25908997 GTGAAAACAGACTAATACACAGG - Intronic
971592389 4:28484737-28484759 ATGAAAAGAAATAAATACATAGG + Intergenic
971599449 4:28573354-28573376 GTGAAAATAGACTAATACACAGG + Intergenic
971755963 4:30709076-30709098 ATGAAATCACAGAAATACAAAGG - Intergenic
971844737 4:31905155-31905177 GTGAAAACAGACTAATACAGAGG - Intergenic
972087967 4:35242954-35242976 GTGAAAACAGACTAACACAATGG + Intergenic
972088983 4:35256634-35256656 GTGAAAACAGACTAATACACTGG + Intergenic
972090494 4:35275651-35275673 GTGAGAACAGACTAATACAATGG - Intergenic
972506205 4:39722663-39722685 GAGAAAACCCACAAAGACGTGGG + Intronic
972878734 4:43397016-43397038 GTGAGAACAGACTAATACACAGG + Intergenic
972927449 4:44028575-44028597 GTGAAAACATATCAAGACATTGG + Intergenic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
973316587 4:48767057-48767079 GTGAGAACAGACTAATACAGTGG - Intronic
973809246 4:54554026-54554048 GTTCAAACTCGCAAATACATTGG + Intergenic
973953117 4:56037513-56037535 GTGAGAACAGACTAATACAATGG - Intergenic
974073156 4:57143855-57143877 GTGAGAACAGACTAATACAGTGG + Intergenic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
974902222 4:68014650-68014672 GTGAGAACAGACTAATACAGTGG + Intergenic
975216655 4:71762909-71762931 GTGAAAATAGACTAATACAAAGG + Intronic
975655413 4:76636630-76636652 GGGAAAACCCACACAGACATGGG - Intronic
976364968 4:84222974-84222996 GTGAAAACAGACTAATACAATGG - Intergenic
976731367 4:88265595-88265617 GTGAGAACAGACCAATACATAGG + Intronic
976766819 4:88606512-88606534 GTGAAAACCGACTAATACAACGG - Intronic
976906612 4:90244455-90244477 GTGAGAACAGACTAATACATAGG - Intronic
977015834 4:91692616-91692638 GTGAAAACAGACTAACACAGCGG - Intergenic
977187185 4:93954454-93954476 GTTAAAACACCAAAATATATAGG + Intergenic
977516283 4:98024234-98024256 GTGAAAACAGACTAATACAGAGG + Intronic
977784451 4:101016472-101016494 ATGAAAATAGACACATACATAGG - Intergenic
977822660 4:101492672-101492694 TGAAAAACACACAATTACATGGG - Intronic
977831381 4:101597718-101597740 GTGAATCCACACAACTACAAGGG - Intronic
978014831 4:103730267-103730289 CTGAAAAGAATCAAATACATGGG + Intergenic
978064555 4:104380319-104380341 GTGTACACACACACATATATAGG - Intergenic
978181012 4:105796030-105796052 ATGAAAACAGACTAATACACAGG - Intronic
978240137 4:106505197-106505219 GTGAGAACAGACGAATACACAGG + Intergenic
978290785 4:107137180-107137202 GTGAAAACTCCCAAGTACACTGG - Intronic
979051092 4:115934219-115934241 ATCAAAACACTAAAATACATAGG + Intergenic
979215205 4:118155324-118155346 GAGAAAACCCACATAGACATGGG - Intronic
979244788 4:118489796-118489818 GTTAACACTCACAAACACATAGG + Intergenic
979496367 4:121387914-121387936 TTAAAAATACACAAATAAATGGG + Intergenic
979940970 4:126762717-126762739 ATGAAAACAGGCTAATACATTGG - Intergenic
980274050 4:130625186-130625208 GTGAGAACAAACTAATACACAGG - Intergenic
980482384 4:133403867-133403889 GTGAGAACAGACTAATAAATAGG - Intergenic
980653840 4:135756708-135756730 GTGACATCACAGAAATTCATGGG + Intergenic
981274140 4:142877892-142877914 ATGAAAACAGACTAATACAGAGG + Intergenic
981502943 4:145472345-145472367 GTGAGAACAGACTAATACATGGG - Intergenic
981591893 4:146373491-146373513 GTGATAACAAATAAATACAAGGG + Intronic
981680146 4:147388393-147388415 GTGAAAACAGACTAATACAGTGG - Intergenic
981772420 4:148325379-148325401 GTTAAAACACACATACACAGAGG - Intronic
982080229 4:151782625-151782647 GTAAAAAAAAAAAAATACATAGG + Intergenic
982214741 4:153071307-153071329 GTGAAAACGGACTAATACAATGG - Intergenic
982416451 4:155138736-155138758 GTGTAAACACATACATATATTGG - Intergenic
982430488 4:155316288-155316310 GTGAGAACAAACTAATACACAGG + Intergenic
982496061 4:156093641-156093663 GTGAGAACAGACTAATACAGGGG - Intergenic
982730939 4:158954463-158954485 GTGAAAACGGACTAATACAAAGG + Intronic
982975638 4:162056119-162056141 GTGAAAAGACAAGCATACATTGG + Intronic
983357880 4:166687537-166687559 TTGCAACCACACAAACACATAGG - Intergenic
983578872 4:169287995-169288017 GTGAAAACAGACTAATACAGGGG - Intergenic
983699793 4:170578430-170578452 ATGAAAACAGACTAATACACCGG - Intergenic
983787785 4:171755977-171755999 ATGAAGACATAAAAATACATTGG - Intergenic
983978924 4:173970465-173970487 ATGATAACACAGAAATACAAGGG - Intergenic
984047953 4:174825978-174826000 GTAAAAACATAAAACTACATAGG + Intronic
984173955 4:176393457-176393479 CTGTAAACAAAGAAATACATTGG - Intergenic
984198074 4:176684102-176684124 TTAAAAACACAGAAATACCTTGG - Intronic
984334439 4:178371039-178371061 CTGAAATCACAGAAATACAAAGG - Intergenic
984355687 4:178654612-178654634 GTGAAAACAGACTAATAGAAAGG + Intergenic
984355826 4:178655723-178655745 GTGAGAACAAACTAATACAAAGG + Intergenic
985308713 4:188573879-188573901 ATGAAAACAGAGTAATACATTGG + Intergenic
985414719 4:189724253-189724275 GCAAAAACACACAAATAAAATGG + Intergenic
986083745 5:4421439-4421461 GGGAAAACACATAAACACAAAGG - Intergenic
986364039 5:7011748-7011770 GTGAGAACAGACTAATACAGAGG - Intergenic
986405791 5:7423682-7423704 GTGAGAACAGACTAATACACTGG + Intronic
986447910 5:7838925-7838947 ATGAAAACAGACTAATACACTGG - Intronic
986455137 5:7911263-7911285 GTGAAAACAGACTGATACAGCGG - Intergenic
986474006 5:8106736-8106758 GTGAAAACAGACTAATACACTGG + Intergenic
986792834 5:11180376-11180398 GTGAAAACAGACTAATACAAGGG + Intronic
986869080 5:12026902-12026924 GTGAAAACAAACTAATACATAGG - Intergenic
986890852 5:12303227-12303249 CTGATAACACAGAAATACAAAGG + Intergenic
987094271 5:14534162-14534184 GTGAGAACAGACTAATACAGGGG + Intergenic
987159965 5:15132194-15132216 GTGCAAACACACACAGACACTGG - Intergenic
987247162 5:16060518-16060540 GTGAAAACAGACTAATACAGAGG - Intergenic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
987433709 5:17866462-17866484 ATGAAAACAGACTAATACAAGGG + Intergenic
987470808 5:18325180-18325202 GTGAAAACGAACTAATACATTGG - Intergenic
987562234 5:19539580-19539602 GTGAGAACAGACTAATACAAAGG - Intronic
987672017 5:21022530-21022552 GTGAAAACAGACTAACACAGGGG + Intergenic
988007524 5:25436403-25436425 GTGAAATCATACATATACATAGG - Intergenic
988017954 5:25583969-25583991 GCAAAAAAACACAAATACCTAGG - Intergenic
988131268 5:27109383-27109405 GTGAAAAAACACAAATTAACAGG + Intronic
988739953 5:34060491-34060513 ATGAAAACAGACTAATACACAGG - Intronic
988888025 5:35581066-35581088 GTGAAAACAGACTAATAGAGGGG - Intergenic
988933447 5:36059848-36059870 GTGAAAACACAAACATACCCTGG - Intronic
989197148 5:38726776-38726798 GTGAAAATAGACTAATACACTGG - Intergenic
989234447 5:39129371-39129393 GAGAAAACACTCCAAGACATTGG + Intronic
989361889 5:40611035-40611057 GTGAAAACGGACTAATACAAAGG - Intergenic
990234075 5:53747716-53747738 CTGAAAACTCACAAATAAATGGG + Intergenic
990287461 5:54313815-54313837 GTGAAAACAGACTAATACAGAGG + Intergenic
990622526 5:57576256-57576278 GTGAGAACAGACTAATACATAGG + Intergenic
990631389 5:57674309-57674331 GTGAAAACGGACTAATACAGAGG - Intergenic
990891593 5:60656522-60656544 ATGAAAACAGACTAATACAGTGG - Intronic
990927560 5:61044971-61044993 TTTAAAATACACAAATAAATGGG - Intronic
991136396 5:63186649-63186671 GTGAAAACAAACTAATACATTGG + Intergenic
991171952 5:63637944-63637966 GGGAAAACACTCACATACACAGG - Intergenic
991172562 5:63645836-63645858 GTGAGAACAGACTAATACAATGG - Intergenic
991406220 5:66303327-66303349 GAGAAAACCCACACAGACATGGG - Intergenic
991463320 5:66882711-66882733 GAGAAGACACACAGATACAGAGG - Intronic
991520356 5:67490500-67490522 ATGAAAACAAACTAATACATGGG - Intergenic
991524892 5:67545380-67545402 TTGAGAACAGACTAATACATAGG + Intergenic
992129608 5:73678627-73678649 GTGTAAATACATAACTACATGGG + Intronic
992547967 5:77833725-77833747 GTCAGAACACACAGATGCATAGG + Intronic
992885678 5:81157560-81157582 GTGAGAACAGACTAATACAAAGG - Intronic
992954369 5:81892061-81892083 GTGAAAACAGACTAACACAGGGG + Intergenic
993073220 5:83191886-83191908 GTGAAGACCAACTAATACATAGG + Intronic
993262274 5:85674084-85674106 GTGAGAACAGAAAAATACAGGGG - Intergenic
993383388 5:87233770-87233792 GAGAAAACCCACACAGACATGGG - Intergenic
993447645 5:88033530-88033552 GTGAAAACAGACTAATACAGTGG + Intergenic
993452306 5:88087218-88087240 GTGAAACCATACAAAAACAAAGG + Intergenic
993481453 5:88429933-88429955 GTGAAAACAGACTAATACAAAGG - Intergenic
993558288 5:89369313-89369335 GTGATACCACAGAAATACAAAGG + Intergenic
993651042 5:90522384-90522406 GTGAACACAGACTAATACAGTGG + Intronic
993797371 5:92284092-92284114 GTGAAAATAGACCAATACAGAGG - Intergenic
993973214 5:94444861-94444883 GTGAAAACGGATTAATACATGGG - Intronic
994036478 5:95207652-95207674 GTAAACACACATAAATACAAAGG + Intronic
994136195 5:96289683-96289705 GTGAAAACGAACAAACACACTGG + Intergenic
994307083 5:98219190-98219212 TTAAAAAGACACAAATACACTGG - Intergenic
994311705 5:98279957-98279979 CTGAAAAGACACAAATACACAGG - Intergenic
994406731 5:99354132-99354154 GTGAAAACAGACTAATACATAGG - Intergenic
994434148 5:99707184-99707206 ATGAAAACAGACTAATACACTGG - Intergenic
994599567 5:101885979-101886001 GAGAAAACCCACACAGACATAGG + Intergenic
994606960 5:101979829-101979851 GTGAAAACAGACTAATATAAGGG + Intergenic
994713819 5:103297993-103298015 GTAAAAACAAAGAAATAAATGGG - Intergenic
994747569 5:103697698-103697720 GGTAAAACACACAAATATGTGGG - Intergenic
995498948 5:112782022-112782044 CTGAAAACAAACTAATACACTGG - Intronic
995679333 5:114699606-114699628 GTGAAAACAAACCAATACAGAGG - Intergenic
995909570 5:117169344-117169366 GTGAAAGCAAACTAATACAATGG + Intergenic
995930121 5:117431461-117431483 GAGAAAACCCACACAGACATGGG - Intergenic
995952314 5:117730805-117730827 GTGAGAACAGACTAATACAGTGG + Intergenic
996313510 5:122134910-122134932 GGGAAAACACTCTAGTACATTGG + Intronic
996473779 5:123891484-123891506 CTGATAACACAAAAATACAAAGG + Intergenic
996508618 5:124294503-124294525 GTGAAAACAGACTAACACAGAGG + Intergenic
996793018 5:127313770-127313792 GTGAGAACTCCCAGATACATTGG + Intronic
996980050 5:129481066-129481088 GTGAGAACAGACTAATACAGGGG - Intronic
996997241 5:129712690-129712712 CTGAAAACAGTCAAGTACATTGG + Intronic
997067747 5:130581868-130581890 GTGGAAAGACACACACACATAGG + Intergenic
997143521 5:131407954-131407976 GTGAAAAGAGAAAAGTACATCGG + Intergenic
997183061 5:131852455-131852477 GTGGAAACAGACTAATACATAGG + Intronic
997300828 5:132803076-132803098 GTGATAACAGACTAATACAATGG + Intronic
997677295 5:135722408-135722430 CTACAAACACACAAATTCATAGG - Intergenic
997871390 5:137508361-137508383 GTGCAAACACACACACACAATGG + Intronic
997929177 5:138058338-138058360 GGGAAAACCCACACAGACATGGG + Intergenic
998069398 5:139185104-139185126 GAGAAAACCCACACAGACATGGG - Intronic
998686431 5:144532182-144532204 GTAAAAACAGACTAATACAGAGG + Intergenic
998824533 5:146087686-146087708 GTGAGAACAGACTAATACACTGG - Intronic
999841328 5:155430804-155430826 ATGAAAACAGACTAATACATTGG + Intergenic
1000561211 5:162791789-162791811 GTGAGAACAAACTAATACAGAGG - Intergenic
1000913991 5:167057863-167057885 GTTAAAACTCACAAATATGTTGG + Intergenic
1001194729 5:169662478-169662500 GTGAAAACAGACTAATACACTGG - Intronic
1001767340 5:174260979-174261001 GTGAGAACAGACTAATACAATGG - Intergenic
1001778962 5:174351166-174351188 ATGAAAACGGACTAATACATGGG - Intergenic
1002520352 5:179789570-179789592 GTGAAAACGGACTAATACACTGG + Intronic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003008657 6:2405697-2405719 GTGAAAACGGACTAATACAAGGG - Intergenic
1003116550 6:3287373-3287395 GTTAAAACACACACTTTCATGGG + Intronic
1003212873 6:4082770-4082792 ATGAAAACTCAGAAATACAGGGG - Intronic
1003883639 6:10500880-10500902 GTAAAATCACACAAACACTTTGG - Intronic
1004341784 6:14814281-14814303 GGGACAACAGACAAATAAATAGG - Intergenic
1004784338 6:18949688-18949710 TTGACACCACACAAATACACAGG - Intergenic
1004798477 6:19116466-19116488 TTGAAAATTCACAAACACATGGG + Intergenic
1004934137 6:20491167-20491189 CTGGAAACTCACAAACACATTGG - Exonic
1005182958 6:23127198-23127220 GTGAAAGCAGACAAATATTTTGG + Intergenic
1005184493 6:23149815-23149837 GTGAGAACAAACTAATAAATTGG - Intergenic
1005206546 6:23411556-23411578 CTGAAAAGACACAAAGTCATGGG - Intergenic
1005286709 6:24335586-24335608 ATGAAAACAGACAAATACAGTGG - Intronic
1005913790 6:30333995-30334017 GTGCAAACACACACACACAAAGG + Intronic
1005983960 6:30858919-30858941 ATGAAAACAGACTAATATATAGG - Intergenic
1006207984 6:32366598-32366620 CTAAAAACACACAAAAAAATTGG + Intronic
1006978977 6:38131124-38131146 CTGACAACACAGAAATACAGAGG - Intronic
1007123473 6:39402789-39402811 TGGAAAACACACAAATCCATAGG - Intronic
1007289306 6:40773205-40773227 GTGAAAACAAACTAATACAGAGG - Intergenic
1007984677 6:46196330-46196352 GTGAAAACAGACTAATACACAGG - Intergenic
1008067446 6:47064102-47064124 ATGAAAAAAGACAAACACATGGG - Intergenic
1008311804 6:49985381-49985403 GTGAAAAAACACAATTTTATTGG + Intergenic
1008345961 6:50427329-50427351 GGGAATTCACAGAAATACATGGG + Intergenic
1008692125 6:53991171-53991193 GTGAAAACGGACTAATACAAAGG + Intronic
1008821775 6:55641475-55641497 GTGAATACACACACACACACAGG - Intergenic
1008926885 6:56896530-56896552 ATGAAAACAAACTAATACAGTGG + Intronic
1009265900 6:61554611-61554633 ACAAAAACACACAAGTACATAGG - Intergenic
1009316916 6:62231191-62231213 GTGAAAACAGACTAATACACTGG - Intronic
1009573158 6:65415626-65415648 GAGAAAAGACAAAAATAGATGGG + Intronic
1009654731 6:66527082-66527104 GTGAGAACAGACTAATACAATGG - Intergenic
1009671768 6:66762605-66762627 GTGAAAACGGACTAATACAATGG + Intergenic
1009779995 6:68257175-68257197 ATGAAAACAGACCAATACAACGG + Intergenic
1010077773 6:71820895-71820917 GTGAAAACAGACCAATACAGTGG - Intergenic
1010551400 6:77227084-77227106 ATGAAAACTGACTAATACATAGG - Intergenic
1010666628 6:78638313-78638335 GTGAAAACAAGGAAATGCATTGG + Intergenic
1010836294 6:80591099-80591121 GTGAAAACAGACTAATACAGTGG - Intergenic
1010872461 6:81059498-81059520 GTGAAAACAAACTAATACAAGGG + Intergenic
1010951719 6:82044985-82045007 GTGAGAACAGACTAATACACTGG - Intergenic
1011177438 6:84579784-84579806 GTGAAAACAAACTAATACAATGG + Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011284388 6:85707553-85707575 ATGAAAACAGACTAATACAGGGG - Intergenic
1011607670 6:89119930-89119952 GTGAAAACGGACTAATACAGTGG - Intergenic
1011958882 6:93060969-93060991 GTGAAAACACACACAAACACAGG + Intergenic
1011990913 6:93516106-93516128 GTGAAAGCACAAACATACAGGGG + Intergenic
1012088427 6:94859566-94859588 GTGAGAACAGACTAATACACCGG - Intergenic
1012589126 6:100958125-100958147 GAGAAAACAAACAAATAAACAGG - Intergenic
1012825105 6:104138164-104138186 GTGAGAACACAGTAATACAATGG - Intergenic
1013396763 6:109748604-109748626 GTGCAAACAGACTAATACACTGG - Intronic
1013404770 6:109832799-109832821 GTGAAAACGGACTAATACAGGGG + Intergenic
1013445292 6:110220308-110220330 GTGAAAACAGACTAATACATGGG - Intronic
1013577171 6:111495189-111495211 GTAAAAACACACATATTCAAAGG - Intergenic
1013884320 6:114944688-114944710 GTGAAAACAGACTAATGCAGAGG - Intergenic
1013916702 6:115347879-115347901 GGGAAAACACACAGAGACAAAGG - Intergenic
1013931375 6:115538008-115538030 CTGACAACACACAAAAACTTTGG + Intergenic
1014053445 6:116984507-116984529 ATGAAAACAGACTAATACATAGG + Intergenic
1014229250 6:118884239-118884261 TTACAAACACAAAAATACATTGG - Intronic
1014234283 6:118937337-118937359 GTGAAAACAGACTAATACATTGG + Intergenic
1014288550 6:119531288-119531310 GTGAAAACAGACTAATACAGTGG + Intergenic
1014342435 6:120227185-120227207 GTGAGAACAGACTAATACATTGG - Intergenic
1014348123 6:120301783-120301805 GTGAAAACGGACTAATACAGTGG - Intergenic
1014502029 6:122203283-122203305 GGGAAAACAGACAAATTCCTAGG - Intergenic
1014629535 6:123771987-123772009 GTGAGAACAAACTAATACAAGGG + Intergenic
1014649341 6:124016982-124017004 GTGAGAACAGACTAATACACAGG - Intronic
1014853082 6:126365267-126365289 GTGACAACAGACTAATACAGTGG - Intergenic
1014875691 6:126655719-126655741 ATGAAAACAGACTAATACACTGG + Intergenic
1014906397 6:127034470-127034492 AAGAAAATACGCAAATACATTGG + Intergenic
1015161700 6:130159408-130159430 GTGAAAACAGACTAATACAGAGG + Intronic
1015172705 6:130271668-130271690 GTGAAAACAGACTAATACAATGG - Intronic
1015580254 6:134716750-134716772 ATGAAAACAGACTAATACACAGG - Intergenic
1015995516 6:138992311-138992333 GAGAAAACCCACACAGACATAGG + Intergenic
1016015918 6:139185702-139185724 AACAAAACACACAAAAACATAGG + Intergenic
1016134709 6:140525282-140525304 GTGAAAATAGACTAATACAAAGG + Intergenic
1016150658 6:140737946-140737968 ATGAAAACAAACAAATACATAGG - Intergenic
1016450633 6:144178947-144178969 ATGAAAACAGACTAATACAGAGG - Intronic
1016520099 6:144937425-144937447 ATGAAAACTGACAAATACAAAGG - Intergenic
1016521153 6:144948495-144948517 GTGAAAATAGACCAATACATAGG + Intergenic
1017020756 6:150138163-150138185 GTGAGAACAGACTAATACAATGG + Intergenic
1017027518 6:150194219-150194241 GTGAGAACAGACTAATACAGTGG + Intronic
1017501749 6:155032175-155032197 GAGAAAACACACAGGAACATTGG - Intronic
1017593973 6:156008740-156008762 GTGAGAACAGACTAATACAATGG + Intergenic
1018227526 6:161643287-161643309 GTTAAAACACACAATTAAACCGG + Intronic
1018446031 6:163859217-163859239 TTGAAAACAGACTAATACACTGG + Intergenic
1018562689 6:165118648-165118670 GTGAAAACGGACTAATACAAGGG + Intergenic
1019084825 6:169466261-169466283 GTGAAAACAGACTAATACTACGG - Intronic
1019232231 6:170577063-170577085 TTTAAAACACAAAAATACTTAGG - Exonic
1019638469 7:2089539-2089561 ATGAAAACAGACTAATACACAGG + Intronic
1019768571 7:2869341-2869363 GTGAAAACAGACTAATACATAGG - Intergenic
1020050112 7:5075878-5075900 ATGAAAACAGACTAATACAGGGG + Intergenic
1020380296 7:7537342-7537364 GAGAAAACCCACACAGACATGGG + Intergenic
1020508720 7:9025024-9025046 GTGAGAACAGACTAATACAGTGG - Intergenic
1020534600 7:9380605-9380627 TATAAAACACACACATACATAGG + Intergenic
1020999570 7:15311741-15311763 GTGAGAACACACACAAACAGTGG + Intronic
1021060828 7:16109237-16109259 CTGATAACACAAAAATACAAAGG + Intronic
1021413625 7:20356284-20356306 ATTAAAACAAATAAATACATTGG - Intronic
1021598430 7:22341062-22341084 GTGAAAACAGAGTAATACACTGG - Intronic
1021680962 7:23131479-23131501 ATGCAAACACAAAAATAAATAGG - Intronic
1021816568 7:24452872-24452894 GAGAAAACCCACACAGACATGGG - Intergenic
1021903644 7:25312142-25312164 GTGAAAACAGACTAATACAGTGG + Intergenic
1022961750 7:35433151-35433173 CTCAAACCACACAATTACATGGG + Intergenic
1023021341 7:36014440-36014462 GTGAAAATGGACAAATACAGGGG + Intergenic
1023597651 7:41849016-41849038 GTGAGAATAGACTAATACATTGG - Intergenic
1024163029 7:46698687-46698709 GTGAAAACAAACTAATATAGTGG + Intronic
1024595049 7:50925518-50925540 CAGACAACACACAAATAAATGGG - Intergenic
1024794984 7:53009186-53009208 GTGAGAACACAAAAACACAGGGG - Intergenic
1025886442 7:65598896-65598918 GTGAGAACAAACTAATACAGAGG - Intergenic
1025910607 7:65825571-65825593 GTTACACCACACAATTACATAGG - Intergenic
1026272476 7:68848614-68848636 GTGAAAACAGACTAAGACAATGG + Intergenic
1026383319 7:69820816-69820838 GTGAAAACACACACACACTCCGG + Intronic
1027415361 7:77968270-77968292 GTGAAAACGGACTAATACACTGG + Intergenic
1027810958 7:82897480-82897502 GTGTATACACACACATACATAGG + Intronic
1028021715 7:85784599-85784621 CTGAAAAGACACAAATAAATAGG - Intergenic
1028032572 7:85934010-85934032 GTGAGAACAAATAAATACACTGG + Intergenic
1028198058 7:87930081-87930103 CTGATAACACAGAAATACAAAGG + Intergenic
1028249542 7:88525230-88525252 ATGAAAACAAACTAATACAGTGG - Intergenic
1028309681 7:89315902-89315924 GTGAAAACACTAAAATTCCTAGG + Intronic
1028333888 7:89627969-89627991 TTAAAAACACACTAATACAAAGG + Intergenic
1028385580 7:90249415-90249437 GTGAAAACAGACTAATACACTGG + Intronic
1029788386 7:102816584-102816606 GTGCAAACACACAGCTACATAGG - Intronic
1029965890 7:104740477-104740499 GTGAGAACAGACTAATACAGTGG - Intronic
1030164598 7:106541067-106541089 GAGAAAACCCACACAGACATTGG + Intergenic
1030215864 7:107043543-107043565 ATGAAAATAGAGAAATACATTGG + Intergenic
1030829986 7:114208931-114208953 GTGAAAACAGACTAATACAAAGG + Intronic
1030912352 7:115266098-115266120 GTGAAAACACAGAATTAAAGAGG - Intergenic
1031091311 7:117358779-117358801 ATGACTACACACAAAAACATGGG - Intergenic
1031490470 7:122381445-122381467 ATGAAAACAGAGAAAAACATTGG - Intronic
1031992050 7:128204929-128204951 GTGAAAACAGACTAATACAGAGG + Intergenic
1032107523 7:129046636-129046658 GTGAGAACACATTAATACATGGG - Intronic
1032150549 7:129425882-129425904 GGGAGACCAAACAAATACATAGG + Intronic
1032624897 7:133581432-133581454 GTGAAAACAAACTAATACAGAGG - Intronic
1032689401 7:134267769-134267791 GTGAAAACGGACTAATACAGGGG + Intergenic
1032733360 7:134666340-134666362 GTGAACACAGAAAAAGACATGGG + Intronic
1032822802 7:135539972-135539994 ATAAAAACAGACACATACATAGG + Intergenic
1033242847 7:139694960-139694982 GTTAAAACACAGAAATCCACAGG + Intronic
1033434437 7:141320282-141320304 GTGAAAACAAACTAATACAGTGG + Intronic
1033852776 7:145517481-145517503 GTGAGAACAGACTAATACACTGG - Intergenic
1033919233 7:146368144-146368166 GAGAAAACACACACATACAAAGG - Intronic
1033967687 7:146997115-146997137 GTGAAAACAAACTAATACAGTGG + Intronic
1034642199 7:152613136-152613158 GTGAAAACAGAGTAATACACAGG + Intergenic
1034728569 7:153363498-153363520 GTGAAAACTGACTAATACAATGG + Intergenic
1035019289 7:155791200-155791222 GTGAATACACACAAATGCAAAGG + Intergenic
1035826300 8:2647600-2647622 GTGTAGACATACAAATACAAGGG - Intergenic
1035843377 8:2836443-2836465 CTGGAAAAACAGAAATACATTGG + Intergenic
1035891153 8:3344675-3344697 GGGAAAATAGACAAACACATTGG - Intronic
1035896698 8:3410691-3410713 GTAAAAACAGACTAATACAGGGG + Intronic
1036483725 8:9161128-9161150 GTTAAAACACACAGAGAGATGGG - Intronic
1036510567 8:9396393-9396415 ATGCACACACACACATACATAGG + Intergenic
1036525675 8:9532361-9532383 GTGAAAAGAGACTAATACAAAGG - Intergenic
1036579313 8:10057899-10057921 GTGAAAACAGACTAACACAAAGG + Intronic
1036697379 8:10985775-10985797 ATGAGAACAGACTAATACATGGG + Intronic
1036950872 8:13137940-13137962 GGGAAAACATCCAAATACAGTGG - Intronic
1037198846 8:16225031-16225053 ATGAAAACAGACTAATACACTGG - Intronic
1037491203 8:19398594-19398616 GAGAGAAGACACAAATGCATGGG + Intergenic
1038177472 8:25194335-25194357 GTGAACAAAAACAAACACATGGG - Intronic
1038707192 8:29905550-29905572 GGGAAAAAACACACACACATGGG - Intergenic
1038812595 8:30865144-30865166 CTGAAACCACAGAAATACAAAGG + Intronic
1039018580 8:33180704-33180726 GTGAAAACAGACTACTACACAGG + Intergenic
1039025123 8:33250334-33250356 TCGAAACCACACAACTACATGGG - Intergenic
1039034864 8:33348975-33348997 GTTACACCACATAAATACATTGG + Intergenic
1039244677 8:35595842-35595864 GTGCAAACACAGAAGTAGATGGG - Intronic
1039488628 8:37930931-37930953 GTGAAAACAAGCTAATACACAGG - Intergenic
1039859528 8:41445007-41445029 ATGCAAACACACATATGCATAGG + Intergenic
1040059454 8:43092076-43092098 GTGAATATACACCAATAAATTGG - Intergenic
1041054594 8:53970986-53971008 TTAAAAACACAAAAATACAAAGG + Intronic
1041115509 8:54531845-54531867 GTGAAAACAGACTAATACATGGG + Intergenic
1041189209 8:55336427-55336449 ATGAAAACAGACTAATACACTGG + Intronic
1041431634 8:57787589-57787611 GTGAAAACGGACTAATACAAAGG + Intergenic
1041651055 8:60303538-60303560 ATGAAAACAGACTCATACATTGG - Intergenic
1041674599 8:60525457-60525479 GTGAAAACGAACGAATACAGTGG + Intronic
1041880353 8:62742763-62742785 GTGAGAACAGACTAATACAATGG - Intronic
1042149861 8:65770224-65770246 TTGAAAACAGACTAATACAGAGG - Intronic
1042360108 8:67872851-67872873 GAGAAAAGACACAAATACCGAGG + Intergenic
1042489928 8:69385478-69385500 ATGAGAACACACTAATACACTGG + Intergenic
1042782368 8:72506092-72506114 GAGAAAACCCACACAGACATGGG - Intergenic
1043074019 8:75673285-75673307 GTGAGAACAGACTAATACAAAGG + Intergenic
1043233878 8:77835988-77836010 TTGAAAAGACAAAAATTCATAGG + Intergenic
1043309357 8:78839119-78839141 GTGAGAACAGACTAATACAGTGG - Intergenic
1043584401 8:81750601-81750623 GTCAAAACAAAAAAATATATAGG + Intronic
1043782724 8:84356228-84356250 GTGAGAACTGACTAATACATAGG + Intronic
1044029142 8:87213319-87213341 GTGAGAACAGACTAATACATGGG - Intronic
1044105891 8:88206395-88206417 GAGAAAACTCACACAAACATGGG - Intronic
1044182626 8:89214913-89214935 GTGAAAACAGACTAATAAACAGG - Intergenic
1044279875 8:90342030-90342052 GTGAAAACGGACTAATACAGTGG + Intergenic
1044453099 8:92361110-92361132 TTAAAGACACACAAAGACATGGG + Intergenic
1044502818 8:92979373-92979395 GTGAAAACAACTAAAAACATTGG - Intronic
1044640520 8:94375609-94375631 GTGAAAACAGACTAATATAGTGG + Intronic
1044641130 8:94382967-94382989 GTGAAAACGGACTAATGCATAGG + Intronic
1044677986 8:94748881-94748903 GTGAAAACAGACTAATACAGGGG - Intronic
1045033940 8:98162900-98162922 GTGAAAGCACACAAATGGTTAGG - Intergenic
1045050194 8:98317310-98317332 GTGAAAACGGACTAATACACAGG + Intergenic
1045050331 8:98318936-98318958 GTGAAAACGAACTAATACAAGGG - Intergenic
1045184321 8:99821048-99821070 GTAAAAAAAAAAAAATACATTGG + Intronic
1045306852 8:100965125-100965147 GTGAAAATGGACTAATACATTGG - Intergenic
1045589656 8:103579723-103579745 GTGAGAACAGACTAATACAGTGG - Intronic
1045676047 8:104608671-104608693 GTGAGAACAGATTAATACATAGG + Intronic
1045724048 8:105149969-105149991 GTGAGAACAGACTAATACAATGG + Intronic
1045785080 8:105911683-105911705 GTGAGAACGAACTAATACATGGG - Intergenic
1045793648 8:106017445-106017467 GTGAAAACAGACTAATATAGAGG - Intergenic
1045974453 8:108115745-108115767 GTGAAAGCAGACCAATACAGTGG - Intergenic
1046032825 8:108804143-108804165 GTGAGAACAGACTAATACACTGG - Intergenic
1046095731 8:109558195-109558217 TTAAAAACATACATATACATGGG - Intronic
1046104303 8:109647513-109647535 GTGAAAACAAACAAGTAAATGGG - Exonic
1046199379 8:110903097-110903119 GTGAGGACAGACTAATACATGGG - Intergenic
1046430875 8:114125908-114125930 GTGAAAACAGACTAATACAATGG - Intergenic
1046587358 8:116163905-116163927 GTGCACACACACATATACATAGG + Intergenic
1046813457 8:118557412-118557434 GTGAGAACAGACTAATACAGGGG + Intronic
1047115472 8:121837097-121837119 ATGAAAACAGACTAATACAATGG + Intergenic
1047195870 8:122720973-122720995 GAGAAAACCCACATAGACATTGG + Intergenic
1047237989 8:123059418-123059440 CTGAAAACACAAAAATCCGTCGG - Intronic
1047607969 8:126493480-126493502 GTGAAAATAGACTAATACAGGGG - Intergenic
1047905070 8:129464289-129464311 GAGAAAACTGACAAATACATAGG + Intergenic
1048079086 8:131105144-131105166 GTGAGAACAGACTAATACAAAGG + Intergenic
1048396580 8:134019785-134019807 GTGAAAACAGACTAATACAATGG + Intergenic
1048397985 8:134033069-134033091 ATGACAACACACACTTACATTGG + Intergenic
1048462152 8:134629830-134629852 GTGAAAACGGACTAATACACTGG + Intronic
1048525867 8:135201894-135201916 GTGAGAACAGACTAATACACTGG - Intergenic
1048542615 8:135356066-135356088 ATGAAAACAGACTAATACACAGG + Intergenic
1048758784 8:137768206-137768228 GTAAAAACAGACTAATACACTGG + Intergenic
1048801671 8:138199571-138199593 GTGAAAACGAACTAATACATAGG - Intronic
1049507061 8:143008463-143008485 GTGCAAACACACAGGTACACTGG + Intergenic
1049902989 9:188458-188480 GTGAAAACAGACTAATACAGTGG - Intergenic
1050006463 9:1136728-1136750 GTGATATCATACAAATACAAAGG - Intergenic
1050422278 9:5478167-5478189 GTGAAAATGGACTAATACATAGG - Intergenic
1050637350 9:7626361-7626383 GAGAAAACACAAACAAACATAGG + Intergenic
1050708699 9:8434323-8434345 GTTTAAACACACAAATAGTTGGG + Intronic
1050794434 9:9520484-9520506 ATGAGAACACACAAATGCATGGG - Intronic
1051309966 9:15758968-15758990 GTGAAAACAGACTAATACAGTGG + Intronic
1051937814 9:22465791-22465813 GTGAGAACAGACTAATACAATGG + Intergenic
1052220493 9:26016580-26016602 GTGAAAACAGACTAATACAGGGG - Intergenic
1052247324 9:26351700-26351722 GTAAAAAAAAAGAAATACATAGG + Intergenic
1052269381 9:26611775-26611797 GTGGAAAGACACAAATATGTGGG - Intergenic
1052282872 9:26753042-26753064 GTGAAAACGGACCAATACAGAGG + Intergenic
1052655758 9:31358133-31358155 ATGAAAACAGACTAATACAGGGG - Intergenic
1052830322 9:33209940-33209962 GTGAGAACAGACTAATACAGTGG - Intergenic
1053356112 9:37447039-37447061 TTGAAAACAGACTAATACACTGG - Intronic
1053619995 9:39805175-39805197 ATGAAAACAGACTAATACAAAGG + Intergenic
1053626700 9:39878767-39878789 ATGAAAACAGACTAATACAAAGG - Intergenic
1053746009 9:41198741-41198763 GTGAAAACAGACTAATACAGTGG - Intronic
1053877521 9:42559118-42559140 ATGAAAATAAACAAATACATTGG - Intergenic
1053878171 9:42564477-42564499 ATGAAAACAGACTAATACAATGG + Intergenic
1053894488 9:42729889-42729911 ATGAAAACAGACTAATACAATGG - Intergenic
1054217187 9:62371936-62371958 ATGAAAACAGACTAATACAAAGG + Intergenic
1054233522 9:62537217-62537239 ATGAAAACAGACTAATACAATGG - Intergenic
1054234173 9:62542604-62542626 ATGAAAATAACCAAATACATTGG + Intergenic
1054264161 9:62902269-62902291 ATGAAAACAGACTAATACAAAGG - Intergenic
1054481261 9:65666476-65666498 GTGAAAACAGACTAATACAGTGG + Intergenic
1054682334 9:68232539-68232561 GTGAAAACAGACTAATACAGTGG + Intronic
1054994732 9:71372973-71372995 TCAAAACCACACAAATACATGGG + Intronic
1055132940 9:72795970-72795992 GAGAAAACAGAAAAAAACATGGG + Intronic
1055230822 9:74063082-74063104 TTGAAATCACACAAATATCTGGG - Intergenic
1055944994 9:81685845-81685867 GTGAAAAGACAGAAATGCAGAGG - Exonic
1056146511 9:83736225-83736247 ATGAAAACACACGAATGCATAGG - Intergenic
1056449521 9:86702543-86702565 GTAAAAACACACAAATTAAACGG + Intergenic
1057084049 9:92192386-92192408 GTGAAAACTGACTAATACACTGG + Intergenic
1057219713 9:93250170-93250192 GAACACACACACAAATACATAGG + Intronic
1057247205 9:93466716-93466738 GTGAAAATACACACATAGGTGGG - Intronic
1057540302 9:95961716-95961738 ATGAAAACAGACTAATACAGTGG - Intronic
1057877669 9:98770355-98770377 GTGAGAACAGACTAATACAGTGG + Intronic
1057937197 9:99250159-99250181 GTAAAAACACAGAAATAATTGGG - Intergenic
1058002080 9:99876147-99876169 GTGAAAACAGACTAATACAGTGG - Intergenic
1058272458 9:102989548-102989570 CTGAAACCACAGAAATACAAAGG + Intergenic
1058296659 9:103316190-103316212 GTGAACACACACAGATACCTGGG + Intergenic
1058316682 9:103576364-103576386 GAGAAAACACACAAACACATGGG + Intergenic
1058329459 9:103740936-103740958 GTGAAAACAGACTAATATAGTGG - Intergenic
1058350011 9:104010204-104010226 GTGAAAACAGACTAATACGGTGG + Intergenic
1058568305 9:106310939-106310961 GTGAAAACAGACTAATACAGGGG + Intergenic
1058627887 9:106954125-106954147 GTGAAAACGGACTAATACACAGG - Intronic
1058999193 9:110330713-110330735 GTGACAACACAAAAACAGATGGG - Intronic
1059559540 9:115319802-115319824 GTGAAAACGGACTAATAAATGGG + Intronic
1059599593 9:115762273-115762295 GTGGAATCCCACAAATACCTGGG - Intergenic
1059775816 9:117474312-117474334 GTGAAAATAAACTAATACACAGG - Intergenic
1059826802 9:118039060-118039082 GTGAGAACAGACTAATACATAGG + Intergenic
1060007837 9:120016098-120016120 GTGAAAACAGACTAATACAGTGG - Intergenic
1060264860 9:122105720-122105742 GTGAAAACAGACTAATACAAGGG - Intergenic
1060388477 9:123256831-123256853 GAGAAAACCCACACAGACATGGG + Intronic
1060460337 9:123847245-123847267 TTGAAAACACACAAAAAAAATGG + Intronic
1060745517 9:126128378-126128400 GTGAAAACAGACTAATACAGTGG + Intergenic
1061011724 9:127959837-127959859 GTGAGAACAGACTAATACAGGGG + Intronic
1061429455 9:130522087-130522109 GTGAAAACAGACTAATACAATGG - Intergenic
1061744740 9:132731199-132731221 CTGAAAACACACAAATCACTCGG - Intronic
1061750199 9:132771789-132771811 GTGAAAACAGACTGATACACAGG - Intronic
1062157726 9:135062804-135062826 ATGAAAACAGACTAATACAGTGG - Intergenic
1062267046 9:135691690-135691712 GTGGACACACACCAACACATGGG + Intergenic
1202782141 9_KI270718v1_random:9514-9536 GTGAAAACAGACTAATACAGTGG - Intergenic
1203638208 Un_KI270750v1:134005-134027 GCAAAAACACACAAATAAAATGG - Intergenic
1185470510 X:379046-379068 GTGCATACACACAAACACACAGG - Intronic
1185470536 X:379459-379481 GTGCATACACACAAACACACAGG - Intronic
1185804862 X:3047805-3047827 ATGAAAACGGACTAATACATTGG - Intronic
1185820152 X:3195069-3195091 GTGAAAACAGAGTAATACAATGG + Intergenic
1185935785 X:4256377-4256399 GTGAAAACGGATTAATACATAGG - Intergenic
1185952961 X:4456664-4456686 ATGAAAACAGACTAATACAATGG + Intergenic
1186135160 X:6511921-6511943 GTGAAAACGGACTAATACAAGGG - Intergenic
1186255282 X:7711552-7711574 GTGAAAACAGACTAATACAGTGG - Intergenic
1186288499 X:8071203-8071225 GTGAAAATGAACTAATACATGGG - Intergenic
1186367655 X:8912172-8912194 TTGAAAACACACAACGACATTGG + Intergenic
1186439680 X:9574976-9574998 GTGAAAACAGACTAATACAGTGG - Intronic
1186587743 X:10894285-10894307 GAGAAAACAGACAACTTCATAGG - Intergenic
1186895240 X:13998623-13998645 GTGAAAACAGACTAATACAGGGG + Intergenic
1187553437 X:20328444-20328466 GTGAAAAAACAGAGATCCATTGG - Intergenic
1187928426 X:24271701-24271723 GTGAGAACAGACTAATACATGGG + Intergenic
1188030345 X:25256433-25256455 GTGAGAACAGACTAATACAGGGG + Intergenic
1188041873 X:25377604-25377626 ATGAAAACAGACTAATACAGAGG + Intergenic
1188535463 X:31191754-31191776 GTGAAAACGGACTAATACAGTGG + Intronic
1188579478 X:31692590-31692612 CTGATAACACAGAAATACAAAGG + Intronic
1188813262 X:34679754-34679776 ATGAAAACAGACTAATACAGAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189953157 X:46252778-46252800 GTGAGAACAGACTAATACACAGG + Intergenic
1190067359 X:47250590-47250612 GCGAGAACAGACAAATACAATGG - Intergenic
1190269504 X:48851828-48851850 ATGAAAACAGACTAATACAGGGG - Intergenic
1190721678 X:53153955-53153977 GTGAGAACAGACTAATACATAGG - Intergenic
1190770599 X:53510952-53510974 GTGAGAACAAACTAATACAATGG - Intergenic
1190922392 X:54867096-54867118 CTGAAACCACAGAAATACAAAGG - Intergenic
1191742183 X:64448055-64448077 GTAAAAACAGACTAATACATGGG - Intergenic
1191745937 X:64486635-64486657 ATGATAACACACAGATATATGGG - Intergenic
1191829753 X:65403579-65403601 GAAAAAAGACACAAATACAATGG + Intronic
1191830362 X:65408237-65408259 GTGAAAAGACAGAAATGCAGAGG + Intronic
1191949545 X:66573376-66573398 GTGAAAACAGAAAAAGACATAGG - Intergenic
1192256900 X:69468990-69469012 GTGAAAACAGACTAATACAGTGG + Intergenic
1192361334 X:70442348-70442370 GAGAAAACCCACACATACATGGG - Intergenic
1192396154 X:70783180-70783202 CTCAAAACACACAACTACATGGG + Intronic
1192846453 X:74910983-74911005 GTGAAAACAAACTAATACTGTGG + Intronic
1193232356 X:79062726-79062748 GTGAAAACAGACTAACACAGTGG + Intergenic
1193252446 X:79308083-79308105 GTGAAAACGGACTAATACAATGG + Intergenic
1193335817 X:80287477-80287499 GAAAAAACACATAAATACAGTGG + Intergenic
1193516098 X:82466284-82466306 GTGAGAACAGACTAATACACAGG - Intergenic
1193749422 X:85324795-85324817 ATAAAAACACACAAGTACATAGG - Intronic
1193932536 X:87572837-87572859 ATGAAAGCACACAAGTTCATAGG + Intronic
1193948744 X:87770773-87770795 GTGAAAACAGACTAATAGAAAGG + Intergenic
1194244036 X:91488209-91488231 GTAAAAATAAACAAATAAATAGG - Intergenic
1194339500 X:92691822-92691844 GTGACAACAGACTAATACAGAGG + Intergenic
1194452534 X:94062126-94062148 TTTAAAAAACAAAAATACATTGG - Intergenic
1194484653 X:94472305-94472327 GTGAAAATGGACTAATACATAGG + Intergenic
1194832228 X:98637748-98637770 GAGAAAACACAGAGATACATGGG + Intergenic
1194868802 X:99101794-99101816 GTGAAAACGGACTAATACAGGGG - Intergenic
1194906096 X:99577512-99577534 GTGAGAACAGACTAATACAGAGG + Intergenic
1195300774 X:103528024-103528046 GTGAAAACGGACTAATACAGAGG - Intergenic
1195424873 X:104717528-104717550 TTGAAAACTTACAAATAAATAGG - Intronic
1195490615 X:105464954-105464976 GAGAAAACCCACACAGACATGGG + Intronic
1195522597 X:105849047-105849069 ATGAAAACAGACTAATACACAGG - Intronic
1195548939 X:106144570-106144592 ATGAAAACAGACTAATACATGGG + Intergenic
1196283588 X:113853280-113853302 GTGAGAACAGACTAATACAATGG + Intergenic
1196294872 X:113985992-113986014 GTGAAAACTGACTAATACAGAGG - Intergenic
1196540591 X:116902316-116902338 TTGAAAATAAAAAAATACATGGG + Intergenic
1196995334 X:121376807-121376829 ATGAAAACAGACTAATACAGGGG - Intergenic
1197015221 X:121616903-121616925 ATGATACCACACAAATACACAGG - Intergenic
1197331279 X:125156102-125156124 GTCAAAACAAAAAAATACAGGGG - Intergenic
1197337157 X:125222006-125222028 GTGAGAACAGACTAATACAAGGG + Intergenic
1197474208 X:126900555-126900577 CTGATACCACACAAATACAGAGG + Intergenic
1197526875 X:127575207-127575229 ATGAGAACACACTAATACATTGG - Intergenic
1197619018 X:128726066-128726088 GTGACAACAAACAGATATATAGG + Intergenic
1197948220 X:131863421-131863443 GTAAAAACACACACACACAGAGG - Intergenic
1198183551 X:134233174-134233196 GTGAAGACACACAGACACATAGG + Intergenic
1198403067 X:136286416-136286438 GTGAAAACAGACTAATACAGAGG - Intergenic
1198545945 X:137692834-137692856 GGGAAAACAAACAAAAAAATAGG + Intergenic
1198569067 X:137935794-137935816 GAAAAAACACAAAAATACTTAGG + Intergenic
1198578120 X:138033041-138033063 GTGAGAACAGACTAATACAATGG + Intergenic
1198609278 X:138379645-138379667 GTGAAAACACACTAATACAATGG + Intergenic
1198611069 X:138401281-138401303 GTGAAAACACACTAATACAATGG - Intergenic
1198707384 X:139463395-139463417 GTGAAAACACACTAATACACCGG + Intergenic
1198981723 X:142405325-142405347 CTGAAAACACTCAAAAACCTAGG + Intergenic
1198990862 X:142513921-142513943 GTGAGAACAGACTAATACAAGGG - Intergenic
1199270855 X:145881403-145881425 GTGAAAACAGACGAATACTTTGG - Intergenic
1199420508 X:147638240-147638262 GTGAAAACAGACTAATACATGGG + Intergenic
1199472520 X:148210537-148210559 GTGAAAACAGATTAATACAGTGG + Intergenic
1200291595 X:154880515-154880537 GTGAAAACATAACAAGACATTGG - Intronic
1200563015 Y:4729541-4729563 GTAAAAATAAACAAATAAATAGG - Intergenic
1200647885 Y:5808603-5808625 GTGACAACAGACTAATACAGAGG + Intergenic
1201459750 Y:14209054-14209076 TTAAAACCACACAACTACATGGG + Intergenic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic
1201536598 Y:15055578-15055600 GGAAACACACACATATACATTGG - Intergenic
1201629319 Y:16052180-16052202 GTGAAAACATACTAATACACAGG - Intergenic
1201766493 Y:17577708-17577730 GTGAAACCAAACAAATTTATGGG + Intergenic
1201835059 Y:18328281-18328303 GTGAAACCAAACAAATTTATGGG - Intergenic
1201905464 Y:19082030-19082052 GGGAAAAAACAAAAATACAATGG + Intergenic
1202096513 Y:21254797-21254819 GTGATACCACAGAAATACAAAGG - Intergenic