ID: 970929872

View in Genome Browser
Species Human (GRCh38)
Location 4:21496987-21497009
Sequence CTCTCTAAGGGGCATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970929862_970929872 29 Left 970929862 4:21496935-21496957 CCTAGTGCCAAAAAAGTTGGGGA 0: 4
1: 129
2: 1236
3: 1739
4: 1500
Right 970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 174
970929860_970929872 30 Left 970929860 4:21496934-21496956 CCCTAGTGCCAAAAAAGTTGGGG 0: 4
1: 114
2: 1206
3: 1730
4: 1397
Right 970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 174
970929863_970929872 22 Left 970929863 4:21496942-21496964 CCAAAAAAGTTGGGGACTGCTGG 0: 4
1: 98
2: 640
3: 1074
4: 1597
Right 970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970929872 Original CRISPR CTCTCTAAGGGGCATGTGGA GGG Intronic
902312984 1:15595971-15595993 CTCTCTAAGGACCAGGTTGATGG - Intergenic
904950720 1:34236413-34236435 ACCTCTAGGGGGCATTTGGACGG + Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907044800 1:51294219-51294241 CTCTCTAAGGGGCAGGGGCTGGG + Intronic
908982597 1:69976816-69976838 CTCTCCAAGGGGAATGTGAGGGG - Intronic
910804421 1:91176468-91176490 CTCCCTAAGGAGCTTGGGGAGGG - Intergenic
912586656 1:110772599-110772621 CTTTATAAGGGGCATTGGGAAGG - Intergenic
915819316 1:159005085-159005107 CACTCTAACGGGCATGTAGGGGG + Intronic
918071093 1:181133832-181133854 CTCTCTCAGGAGCCTGTGGGAGG - Intergenic
922681952 1:227606219-227606241 CTCTCCAAGGGGAGTGTGGCAGG + Intronic
924795445 1:247289203-247289225 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1062888591 10:1038629-1038651 CCCCCTAAGGGGCAGGTGGAGGG + Intergenic
1063125103 10:3130069-3130091 CTTTCCAAGGGGCATGGAGATGG + Intronic
1068727638 10:60320887-60320909 CTCTCTACTGGGTATGTGTAGGG + Intronic
1069080531 10:64083770-64083792 TCTTCTAAGGGACATGTGGAAGG + Intergenic
1069303526 10:66938928-66938950 CTTTCTCAGGAGGATGTGGACGG - Intronic
1069691396 10:70355396-70355418 CTCTATAAGGGGCATGAGACAGG - Intronic
1073493094 10:103867937-103867959 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
1073822329 10:107278701-107278723 CTCTTTAAGGCTCATGTGTAAGG - Intergenic
1075060301 10:119252432-119252454 CTCTCTCTGGGCCGTGTGGATGG + Intronic
1077033074 11:478955-478977 CTCTCCCAGGGGCCTGTGAAGGG + Intronic
1078063439 11:8062439-8062461 CGCTGTCAGGGGCCTGTGGAGGG + Intronic
1079608795 11:22404659-22404681 CTCTCTAAAGGTCCTGTGGTGGG - Intergenic
1081301135 11:41453375-41453397 ATCTCTAAGGGGCCTCTGAAAGG - Intronic
1082734257 11:56838798-56838820 CTCTGTTAGGGCAATGTGGAAGG - Intergenic
1084548398 11:69825952-69825974 CTCTCTTAGCTGCATCTGGAAGG - Intergenic
1086311112 11:85537245-85537267 CTCTCTCAGGAGGATGTGGGTGG + Intronic
1087180951 11:95142139-95142161 CCCTCTAAGGGGCATGCCCAGGG + Intergenic
1088431917 11:109768289-109768311 CGCTTTAAGAGGGATGTGGAGGG - Intergenic
1088967547 11:114738851-114738873 CTCCATAATGGGCATGTGTAGGG - Intergenic
1091488186 12:909748-909770 ATCAATAAAGGGCATGTGGAAGG + Exonic
1091816777 12:3444836-3444858 CACCCGAAGGGGCATGTGCAGGG - Intronic
1097319284 12:58207503-58207525 CTCTCTAAGTGGCAAGGAGACGG - Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1104131799 12:125901042-125901064 CTCCCAGAGGGGAATGTGGATGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1106017004 13:25879046-25879068 TGGTCTATGGGGCATGTGGACGG + Intronic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1108415377 13:50193107-50193129 ATCTCGAAGAGGCAAGTGGAAGG - Intronic
1112092113 13:96092047-96092069 CTCCCTAAGTGGCTTTTGGATGG + Intronic
1113579182 13:111416895-111416917 CTCTCTGTGGGGCGTGTGGATGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1114468786 14:22944222-22944244 CTCTCTAAATGGCATGGGGATGG - Intergenic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1115402517 14:32978364-32978386 CTCTCTGAGTTGTATGTGGATGG - Intronic
1118662715 14:68031928-68031950 CCTTCTAAGGTGAATGTGGATGG - Intronic
1118942013 14:70347076-70347098 CTCTTTAAGGGTAATGCGGACGG - Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122518018 14:102322101-102322123 ATCTCTGAGGGGCATTTTGAAGG - Intronic
1123205624 14:106710377-106710399 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123210674 14:106757652-106757674 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1124340631 15:28887198-28887220 CTCCTAAATGGGCATGTGGAGGG + Intronic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1124926842 15:34078315-34078337 CTCTCTAAGGAGAGTTTGGAAGG + Intergenic
1125402880 15:39322649-39322671 CAAGCAAAGGGGCATGTGGAGGG + Intergenic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1127646273 15:60962529-60962551 AACTCTAAGTGGCATGTCGAGGG - Intronic
1128206120 15:65853665-65853687 TTTTCTAACTGGCATGTGGAGGG - Intronic
1129300664 15:74623730-74623752 GTCACTAGGGGGCAGGTGGAGGG + Intronic
1129910930 15:79225730-79225752 CTCTCAAAGGAGCATATGGCTGG + Intergenic
1132854490 16:2038722-2038744 CTCTCCGAGGGGCCTGAGGATGG + Exonic
1134602616 16:15545412-15545434 CTCTCTAAGGGAAGTCTGGATGG - Intronic
1135012626 16:18895526-18895548 CACTCTAGGGGGCAGGGGGAAGG + Intronic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137597530 16:49734663-49734685 CTCCCTCAGGGCCATGTGCATGG + Intronic
1137745931 16:50819940-50819962 CTCTCTCCTGGGCTTGTGGATGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1146750506 17:35374044-35374066 CTCTCCGAGGGGTATCTGGAAGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148731824 17:49841509-49841531 CTCCCTAGGGGGCATGTTGAAGG + Intronic
1151322106 17:73358561-73358583 CTCTATAAGGGCCTTTTGGAAGG + Intronic
1153979095 18:10294247-10294269 CGCTCTAAGAGGGATGTGGAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1158939434 18:62393302-62393324 CCCTCTCTGGGGCATTTGGAAGG + Intergenic
1162584519 19:11550986-11551008 CTCTCCCAGAGGCTTGTGGATGG + Intergenic
1165974762 19:39665995-39666017 CTCTGCTAGGGCCATGTGGAAGG - Intergenic
1166202706 19:41248855-41248877 CTGTCTCAGGGGCATAGGGAAGG - Intronic
1166813367 19:45527201-45527223 CCTCCTAAGGGGCATGGGGAGGG - Intergenic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
926484266 2:13435377-13435399 CTATCTATGTGGCCTGTGGATGG - Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
930449853 2:51521899-51521921 ATCTCAAAGGGACAAGTGGATGG - Intergenic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
936071389 2:109374069-109374091 CTCCCTCAGGGCCATGAGGAGGG + Intronic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
936907329 2:117551972-117551994 CCCTCTAAGAGGCATGTAAATGG + Intergenic
937829441 2:126403439-126403461 TTGTCTAAGAGGCCTGTGGATGG - Intergenic
937908897 2:127065871-127065893 CTCTTTAGGAAGCATGTGGAAGG + Intronic
938976184 2:136480718-136480740 CCCTCCCAGGGGCATGTGGGAGG + Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
943014536 2:182495102-182495124 CTTTCTAAGGTGCACGTGGCCGG + Intronic
945098341 2:206240262-206240284 CTCTCTAACAGGGATGTGGGAGG - Intergenic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
948733550 2:239983005-239983027 CTCTCTCAGGGGTGTGTGCAAGG + Intronic
1173403719 20:42746968-42746990 CACTCTAAGGGGCACATGGTGGG + Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174765235 20:53247407-53247429 CTCTTGGAGGGCCATGTGGAGGG - Intronic
1176874827 21:14117118-14117140 TTCTCTGAGGGGCATCTGCATGG - Intronic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1177411894 21:20739883-20739905 TTCTCGAAGGGGCATCTAGAAGG - Intergenic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG + Intergenic
1181786683 22:25232187-25232209 CACTCTCAGGGGCATGTGATGGG + Intergenic
1182992148 22:34778227-34778249 CTCTGTTAGGGCCATGTGAAAGG + Intergenic
1183469574 22:37998349-37998371 CCCTTCAAGGGGCAGGTGGAAGG - Intronic
1183540132 22:38425007-38425029 CTCTCTTAGGGTCCTGTGGGTGG - Intergenic
1184116008 22:42422721-42422743 CCCTCAAAGGGGCATCAGGATGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
949799836 3:7891641-7891663 CTCTCTCAGTGGAATGTAGAAGG - Intergenic
952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG + Intronic
961865085 3:129948105-129948127 CTCTCTAGGGAGTATCTGGATGG + Intergenic
962662002 3:137611680-137611702 TTCTCTAATGAGCATGTGGCTGG - Intergenic
965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
973710719 4:53627849-53627871 CTCCCAAAGGGGCATGCAGAAGG - Intronic
973980654 4:56305739-56305761 GTCCCCAGGGGGCATGTGGAGGG + Intronic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974950497 4:68579322-68579344 CTCTTTAAGGGTGATGTGGATGG - Intronic
974958884 4:68674841-68674863 CTCTTTAAGGGTGATGTGGATGG - Intergenic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
975964566 4:79955557-79955579 CTCTCTGAGGGCAATGTGCAGGG + Intronic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
979460012 4:120971251-120971273 CTCTCTAAAGAGCCTCTGGAAGG + Intergenic
982116717 4:152104318-152104340 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
990185153 5:53203441-53203463 CTCTTTAAGGGTAATGCGGACGG - Intergenic
991146529 5:63312543-63312565 CAGCCTAAGGGGTATGTGGAAGG + Intergenic
994772743 5:104003769-104003791 CTATCTAGGGGGAATGTGAAAGG + Intergenic
994881320 5:105500747-105500769 CTCTCTCATTGGCATGTAGATGG + Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1001990808 5:176114142-176114164 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1002226066 5:177723998-177724020 CTCACTAAGCAGCCTGTGGAGGG + Exonic
1002267779 5:178047212-178047234 CTCACTAAGCAGCCTGTGGAGGG - Exonic
1002871580 6:1171160-1171182 CTCACTGAGGAGTATGTGGAAGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004580406 6:16945916-16945938 ATTTCTAAGTGGCATGTGCATGG - Intergenic
1004753317 6:18585420-18585442 CTCTCCAAGGGCAATGTGCACGG + Intergenic
1005339686 6:24831551-24831573 GTCTCTGAGGGGCATGAAGAGGG - Intronic
1005841209 6:29745640-29745662 CTCGCTGAGGGACATCTGGATGG - Intergenic
1005922447 6:30414775-30414797 CTCGCTGAGGGACATCTGGATGG + Intergenic
1006072101 6:31505682-31505704 CTCGCTGAGGGACATCTGGATGG + Exonic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1008547283 6:52594371-52594393 CTCTCCAAGGGGCATGGGGGAGG + Intergenic
1009733001 6:67634452-67634474 CTCTACTAGGGCCATGTGGAGGG + Intergenic
1012033224 6:94099586-94099608 CTCTTTTAGGGGAATTTGGAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014346809 6:120280753-120280775 TTCTCTTAGATGCATGTGGATGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1018840084 6:167510162-167510184 CTGTCTAAGGGGCCTGTGATTGG + Intergenic
1022003368 7:26246050-26246072 CTCTTTAAGGGTAATGCGGATGG - Intergenic
1022129157 7:27387992-27388014 CTCTCTGAAGGGCACTTGGAAGG + Intergenic
1023966946 7:44967706-44967728 CACTCTACGGGCCATGTGGCCGG - Exonic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1027917434 7:84343569-84343591 CTCTCTAAGGGAAATGTGTCTGG + Intronic
1028581718 7:92416021-92416043 CTCTAGAAGGGCTATGTGGATGG - Intergenic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1032511935 7:132479522-132479544 CTCACTAAGGTGCGGGTGGAAGG - Intronic
1032563403 7:132915364-132915386 TTCTGGAAGTGGCATGTGGAGGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1035288762 7:157823867-157823889 GTCTCTAAGGGGAATCTGGAGGG + Intronic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1042158145 8:65866265-65866287 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1042774940 8:72419698-72419720 CTCTCTAAGGGCCTTTAGGAAGG + Intergenic
1045467149 8:102480792-102480814 CTCTCTAAGTGGAATGATGACGG + Intergenic
1046718959 8:117597417-117597439 CCCTGTAAAGGGGATGTGGATGG - Intergenic
1049813080 8:144584996-144585018 CTCTGCAAGGAGCCTGTGGATGG + Intronic
1050945420 9:11511061-11511083 CTCTCTTAGGGCAATGTGGAAGG + Intergenic
1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
1052031235 9:23631266-23631288 CACTCTAAGGGAGATGAGGAGGG - Intergenic
1052249489 9:26380636-26380658 TTCTCTGAGGGGGATGTGTATGG - Intergenic
1052524239 9:29592892-29592914 CTATCTAAAGGTCATTTGGAGGG + Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1053103589 9:35391655-35391677 CTCACTAAGTGGCATCTGGAGGG - Intronic
1056377268 9:86026596-86026618 CTCTCTAAGGGGTAAGTAGGAGG - Exonic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1059303863 9:113338969-113338991 CTCTCTAAGGGATATGTTGTTGG - Intronic
1060522568 9:124301978-124302000 CCCTCCATGGGGCATGTGGCCGG - Exonic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1192196378 X:69031518-69031540 ATCACCAAGGGGGATGTGGAGGG + Intergenic
1195271977 X:103241140-103241162 CTCTCTAAGGGGCAGATTTATGG - Intergenic
1198969411 X:142265421-142265443 CAATCTAGGGGGCATGTGGCAGG - Intergenic
1199399221 X:147377054-147377076 CTATCCTAGGGGCATGTGAAAGG + Intergenic
1199845751 X:151692099-151692121 CTCTCTTGGTGGCTTGTGGATGG + Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic