ID: 970931277

View in Genome Browser
Species Human (GRCh38)
Location 4:21515179-21515201
Sequence ACTAGGCTGGAGCTCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 1, 2: 6, 3: 63, 4: 863}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970931268_970931277 12 Left 970931268 4:21515144-21515166 CCATCGCTTCCCTAGAGATTTCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG 0: 1
1: 1
2: 6
3: 63
4: 863
970931272_970931277 -9 Left 970931272 4:21515165-21515187 CCATATGCCCCTCAACTAGGCTG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG 0: 1
1: 1
2: 6
3: 63
4: 863
970931269_970931277 3 Left 970931269 4:21515153-21515175 CCCTAGAGATTTCCATATGCCCC 0: 1
1: 0
2: 1
3: 18
4: 133
Right 970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG 0: 1
1: 1
2: 6
3: 63
4: 863
970931270_970931277 2 Left 970931270 4:21515154-21515176 CCTAGAGATTTCCATATGCCCCT 0: 1
1: 0
2: 4
3: 33
4: 212
Right 970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG 0: 1
1: 1
2: 6
3: 63
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970931277 Original CRISPR ACTAGGCTGGAGCTCAGTGA TGG Intronic
900866104 1:5269692-5269714 ACTGGGCTAGAGCTAAATGAGGG - Intergenic
901288359 1:8101214-8101236 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
901357349 1:8662653-8662675 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
901495343 1:9618006-9618028 ACTGAGCTGGACCACAGTGAAGG + Intergenic
901584781 1:10280275-10280297 GCTAGGCTGGAGTTCAGTGGCGG + Intronic
901887389 1:12231950-12231972 CCCAGGCTGGAGTGCAGTGACGG - Intronic
903072661 1:20734586-20734608 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
903939281 1:26917841-26917863 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
904134476 1:28300686-28300708 ACTAGGCTGGAGTGCAGTGTTGG - Intergenic
904179627 1:28657041-28657063 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
904216339 1:28923153-28923175 CCCAGGCTGGAGTGCAGTGATGG + Intronic
904486900 1:30831037-30831059 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
904681589 1:32233195-32233217 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
904776432 1:32910746-32910768 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
904795688 1:33054798-33054820 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
905187778 1:36209017-36209039 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
905373644 1:37502658-37502680 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
905542050 1:38767685-38767707 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
905756233 1:40511919-40511941 CCCAGGCTGGAGCACAGTGGTGG + Intronic
906062262 1:42956912-42956934 ACTAGCCTGGAGCTCAGAGAAGG - Intronic
907344359 1:53762055-53762077 ACTATGATGTAGCTCAGTGTGGG + Intergenic
907456101 1:54576453-54576475 CCTAGGCTGGAGTGCAGTGGGGG - Intronic
907495098 1:54838437-54838459 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
907799976 1:57754841-57754863 TGTAGGCTGGAGCTCAGGGCAGG - Intronic
907876962 1:58499440-58499462 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
910334678 1:86113791-86113813 CCCAGGCTGGAGTGCAGTGATGG - Intronic
910597930 1:88999243-88999265 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
910774814 1:90864034-90864056 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
910885378 1:91958256-91958278 CCTAGGCTGGAGTCCAGTGGTGG + Intronic
910894968 1:92059391-92059413 CCAAGGCTGGAGTGCAGTGACGG - Intronic
911334890 1:96571114-96571136 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
911923671 1:103798816-103798838 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
912259441 1:108095686-108095708 ACTAGACTAGAGCTCCATGAAGG + Intergenic
912340170 1:108906839-108906861 CCCAGGCTGGAGTGCAGTGACGG + Intronic
912561171 1:110552509-110552531 ACCAGACGGGAGCTCTGTGAGGG + Intergenic
912685266 1:111757094-111757116 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
913223800 1:116680890-116680912 GGTGGGCTGGAGCTCAGTGAGGG + Intergenic
914338339 1:146737475-146737497 CCCAGGCTGGAGTTCAGTGACGG + Intergenic
914730959 1:150369821-150369843 CCTAGGCTGGAGTACAGTGGCGG + Intronic
915188288 1:154125808-154125830 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
915379933 1:155431331-155431353 CCAAGGCTGGAGTGCAGTGAAGG + Intronic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
916608633 1:166367846-166367868 ACCAGGCAGGTGATCAGTGAAGG - Intergenic
916783406 1:168060844-168060866 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
917038601 1:170777594-170777616 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
917123913 1:171669122-171669144 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
917148989 1:171924940-171924962 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
917358450 1:174150792-174150814 CCTAGGCTGGAGTACAGTGGCGG + Intergenic
918069977 1:181127635-181127657 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
918570263 1:185982481-185982503 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
918645026 1:186893879-186893901 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
918703101 1:187630432-187630454 ACTAAGCTGGAGCTCAATTTGGG + Intergenic
918961619 1:191285191-191285213 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
919408081 1:197209385-197209407 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
919486572 1:198155190-198155212 AATAGGCAGGAGGTCAGTGTAGG - Intergenic
919703986 1:200658651-200658673 CCCAGGCTGGAGTGCAGTGACGG - Intronic
919836833 1:201580727-201580749 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
920215328 1:204358692-204358714 AGGAGGCTGGAGCTCAGAGCTGG - Intronic
920236564 1:204510788-204510810 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
920394720 1:205636220-205636242 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
920553176 1:206882213-206882235 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
920575185 1:207053944-207053966 GCTAGGCTGGAGTGCAGTGGCGG + Intronic
920575997 1:207060841-207060863 CCCAGGCTGGAGTGCAGTGACGG + Intronic
920639417 1:207737435-207737457 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
920712223 1:208306217-208306239 ACTTGCCTGGAGCAGAGTGAGGG + Intergenic
921084846 1:211779808-211779830 CCCAGGCTGGAGTGCAGTGATGG - Intronic
921095456 1:211883629-211883651 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
921509906 1:216015522-216015544 ACAGGACTGGATCTCAGTGATGG - Intronic
921602117 1:217117185-217117207 ACTAAGCTGGGGCTTAGAGAAGG - Intronic
922283170 1:224144715-224144737 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
923059294 1:230455819-230455841 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
923161870 1:231321681-231321703 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
923190938 1:231620203-231620225 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
923558465 1:235020621-235020643 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
923659756 1:235947880-235947902 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
923903933 1:238361837-238361859 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
924101005 1:240602770-240602792 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
924221346 1:241878452-241878474 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
924721119 1:246624018-246624040 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1064087249 10:12354466-12354488 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1064806081 10:19135195-19135217 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1064989306 10:21242160-21242182 CCCAGGCTGGAGCACAGTGGTGG - Intergenic
1065450008 10:25847468-25847490 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1065512977 10:26497767-26497789 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1065557796 10:26934055-26934077 CCCAGGCTGGAGCGCAGTAACGG + Intergenic
1065570907 10:27070355-27070377 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1065584812 10:27207231-27207253 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1065728638 10:28691046-28691068 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1065825898 10:29571263-29571285 AACAGACTGGAGCCCAGTGATGG + Intronic
1065945410 10:30601517-30601539 CCTAGGCTGGAGTGCAGTGATGG - Intergenic
1065951461 10:30655394-30655416 AACAGACTGGAGCCCAGTGATGG - Intergenic
1066083067 10:31951151-31951173 TCTAGGCTGTAGCTCATGGAGGG + Intergenic
1066679839 10:37927036-37927058 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1066958429 10:42195630-42195652 TCCAGGCTGGAGTGCAGTGATGG - Intergenic
1067884487 10:50075448-50075470 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
1067899145 10:50219884-50219906 ACTTGGCTGGAGCTGAGTAGAGG - Intronic
1068481320 10:57591664-57591686 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1068714613 10:60174777-60174799 ACCAGGCTGGGGTGCAGTGATGG + Intronic
1069448981 10:68500886-68500908 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1069655783 10:70087138-70087160 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1070256853 10:74820478-74820500 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1070294932 10:75152477-75152499 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1070566893 10:77610415-77610437 CCGAGGCTGCGGCTCAGTGAGGG - Intronic
1070580946 10:77718793-77718815 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1070894713 10:79973573-79973595 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1072384142 10:94906529-94906551 CCTAGGCTGGAGTGTAGTGATGG + Intergenic
1072687366 10:97546224-97546246 GCTGGCTTGGAGCTCAGTGATGG - Intronic
1072690314 10:97568462-97568484 GCTAGGCTGAGGCTCAGTGGTGG + Intronic
1072937139 10:99724223-99724245 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1073194482 10:101677741-101677763 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1073518754 10:104104650-104104672 CCTAGGCTGGAGTTCAGTTTTGG + Intergenic
1073828378 10:107353215-107353237 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1074949538 10:118317574-118317596 ATAAGGCTGGTGTTCAGTGATGG - Intronic
1075204136 10:120432132-120432154 GCTTGGCTGGAGTTCAGGGAAGG + Intergenic
1076010123 10:126980988-126981010 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
1076130491 10:128010623-128010645 CCCAGGCTGGAGGGCAGTGAGGG + Intronic
1076150382 10:128157502-128157524 GCTTGGCTGGAGTTCAGTGGGGG + Intergenic
1076732234 10:132444675-132444697 CCTAGGCTGGTGCTCAGAAATGG - Intronic
1077587882 11:3468151-3468173 TCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1077738343 11:4816744-4816766 CCCAGGCTGGAACTCAGTGGCGG + Intronic
1078202547 11:9196651-9196673 CCCAGGCTGGAGCGCAGTGGTGG + Intronic
1078551885 11:12286830-12286852 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1078725308 11:13924821-13924843 TCTAGCCTGGGGCTCAGAGAAGG - Intergenic
1078951193 11:16136441-16136463 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
1079101206 11:17543473-17543495 AGTAGGCTGGATCTCTTTGATGG + Intronic
1079323980 11:19476015-19476037 ACTAGGCTGGAGTGCAGCGGCGG + Intronic
1080075407 11:28141643-28141665 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1080090074 11:28337304-28337326 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1080679780 11:34463595-34463617 ACAAGCATGGAGCTCTGTGATGG - Intronic
1081380645 11:42410374-42410396 AATAGGCTGAGGCTCAATGAAGG + Intergenic
1081581269 11:44353779-44353801 CCTAGGCTGGAGGGCAGTGGTGG - Intergenic
1081823362 11:46022410-46022432 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1081887753 11:46513747-46513769 AATTGGCTGGAGCTAAATGATGG - Intronic
1082012278 11:47458302-47458324 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1082702051 11:56443975-56443997 TCCAGGCTGGAGTGCAGTGATGG - Intergenic
1083230197 11:61312639-61312661 ACCAGGCTGGAGCGCAATGGTGG + Intronic
1083283103 11:61639561-61639583 TGCAGGCTGGAGTTCAGTGACGG - Intergenic
1083516217 11:63261661-63261683 ACTAAGCTTGAGCTTAGTGCGGG - Intronic
1083788861 11:64971383-64971405 CCCAGGCTGGAGTTCAGTGGGGG - Intronic
1083892348 11:65602158-65602180 CCCAGGCTGGAGCGCAGTGGCGG - Intronic
1083973245 11:66096258-66096280 CCAAGGCTGGAGTACAGTGATGG + Intronic
1084062135 11:66683108-66683130 CCCAGGCTGGAGCGCAGTGGCGG + Intergenic
1084072766 11:66746834-66746856 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1084206756 11:67599103-67599125 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1084416668 11:69036476-69036498 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1084829108 11:71754771-71754793 TCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1085252251 11:75151528-75151550 ACATGGCCGGAGTTCAGTGAAGG + Intronic
1085767356 11:79294804-79294826 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1086050301 11:82581373-82581395 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1086305569 11:85478048-85478070 CCTAGGCTGGAGTGCAGTGATGG + Intronic
1086414927 11:86579140-86579162 ATTAGACTGAAACTCAGTGAAGG - Intronic
1087242933 11:95800436-95800458 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1087505260 11:99012924-99012946 CCCAGGCTGGAGCGCAGTGACGG - Intergenic
1088007364 11:104958916-104958938 CCTAGGCTGGAGGGCAGTCATGG - Intronic
1088051110 11:105516549-105516571 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1088096761 11:106109270-106109292 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1088132668 11:106513065-106513087 GCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1088242246 11:107784501-107784523 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1088639508 11:111857979-111858001 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1089005107 11:115084430-115084452 AGGAGGCTGGGACTCAGTGAGGG - Intergenic
1089456532 11:118629019-118629041 AGTAGGCTGAAGCTCAGAGAGGG + Intronic
1089513948 11:119019482-119019504 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
1090015049 11:123078685-123078707 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1090345579 11:126066750-126066772 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1090797525 11:130147668-130147690 CCCAGGCTGGAGTACAGTGACGG + Intergenic
1091497169 12:982706-982728 CATAGGCTGGAGCGCAGTGGTGG + Intronic
1092308097 12:7322500-7322522 ACTGGGCTGGAGCTATATGAGGG + Exonic
1092370642 12:7914366-7914388 CCCAGGCTGGAGCGCAGTGGCGG + Intergenic
1092414127 12:8276906-8276928 TCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1092735908 12:11582580-11582602 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1092768105 12:11871229-11871251 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1093144167 12:15544463-15544485 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1093490679 12:19700895-19700917 ACTATGCTGGAGCTCTCTAATGG - Intronic
1093779768 12:23121795-23121817 AGGAGGCTGGAGTTCAGTCATGG - Intergenic
1093853912 12:24075224-24075246 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1094296208 12:28908489-28908511 TATAGACTGGAGCTAAGTGATGG + Intergenic
1094546386 12:31408254-31408276 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1094602518 12:31922191-31922213 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1094637659 12:32242171-32242193 CCTAGGCTGGAGCGCAGTGATGG - Intronic
1095653466 12:44641737-44641759 TCCAGGCTGGAGTTCAGTGGTGG + Intronic
1096246457 12:49991528-49991550 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1096484165 12:51966489-51966511 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1096629343 12:52915665-52915687 GCTGGGCTGGAGTTCAGTGGTGG - Intronic
1096725069 12:53554818-53554840 CCCAGGCTGGAGCTTAGTGGTGG - Intronic
1098006682 12:66004611-66004633 CCCAGGCTGGAGTTCAGTGGCGG - Intergenic
1098306688 12:69109533-69109555 CCCAGGCTGGAGCGCAGTGGTGG + Intergenic
1098649590 12:72947730-72947752 AATGGGCAGGAGCTCTGTGAAGG - Intergenic
1098913046 12:76229756-76229778 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1099448389 12:82778804-82778826 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1099452176 12:82820918-82820940 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1099510575 12:83530739-83530761 ACCAGGCTGCAGCGCAGTGGTGG + Intergenic
1099546505 12:83987775-83987797 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1100018738 12:90044621-90044643 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1100458240 12:94773616-94773638 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1100493628 12:95104477-95104499 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1100530092 12:95454786-95454808 ACTTACCTGGGGCTCAGTGAGGG + Intergenic
1101149241 12:101869227-101869249 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1101204648 12:102474474-102474496 ACCAGTCTGGAGATCAGTAAGGG - Intronic
1101665460 12:106808995-106809017 ACTATTCTGGAGCTCAAAGAAGG + Intronic
1102086196 12:110142202-110142224 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1102505302 12:113380934-113380956 ACCAGGCTGCAGCCCAGTGCTGG + Intronic
1102670683 12:114616344-114616366 ACTAGACTGGAGGTCAGTGGTGG - Intergenic
1102760987 12:115384821-115384843 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1103396092 12:120608294-120608316 ACCAGGCTGGAGTGCAATGACGG - Intergenic
1103405871 12:120674846-120674868 TCCAGGCTGGAGCACAGTGGCGG - Intergenic
1103454851 12:121057137-121057159 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
1103976772 12:124707764-124707786 ACCACCCTGGAGCTCAGTGGAGG - Intergenic
1104251848 12:127102107-127102129 ACCAGGCTGGAGTTCAGTGGCGG - Intergenic
1104385082 12:128343379-128343401 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1104429470 12:128705105-128705127 ACGTGGCTGCAGTTCAGTGATGG + Exonic
1104805091 12:131584829-131584851 ACTAAGCTGGGGCTACGTGACGG - Intergenic
1105533965 13:21246689-21246711 ACTGGACTGGATCTCAGTGCAGG - Intergenic
1105835926 13:24211964-24211986 ACGTGGCTGGAGCTCTCTGATGG + Intronic
1106951133 13:34885212-34885234 ACCAGGCTGGAGTGCAGTGAAGG - Intergenic
1107053175 13:36074426-36074448 CCCAGGCTGGAGCTCACTGCAGG - Intronic
1107255121 13:38416965-38416987 CCCAGGCTGGAGCACAATGATGG + Intergenic
1107672820 13:42763946-42763968 ACCAGGCTGGAGTACAGTGGCGG - Intergenic
1107866760 13:44710585-44710607 CCTAGGCTGGAGCACAGTGGTGG - Intergenic
1107908788 13:45085940-45085962 ACCAGGTTGGTGCTCACTGAGGG + Intergenic
1107931744 13:45312827-45312849 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1107987854 13:45791218-45791240 ACTAGGTTGGAAGTCATTGAGGG + Intronic
1108417781 13:50217810-50217832 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1108602698 13:52008295-52008317 GCTAGGCTGGAGTGCAGTGGCGG - Intronic
1108839349 13:54593217-54593239 ACTCTGCTGGAGCTCTCTGATGG - Intergenic
1108988257 13:56622397-56622419 ACCAGGCTGGAGCGCAGTGGCGG - Intergenic
1109424543 13:62153113-62153135 ACTTACCTGGGGCTCAGTGAGGG - Intergenic
1110284399 13:73732764-73732786 ACGAGTCTGGAGCTCAGGGAAGG - Intronic
1110545044 13:76746498-76746520 CCTAGGCTGGAGTGTAGTGATGG - Intergenic
1111425669 13:88078007-88078029 ACTCGGCTGAACCCCAGTGAGGG - Intergenic
1111529926 13:89523332-89523354 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1111984734 13:95054503-95054525 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1112222805 13:97508212-97508234 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1112541425 13:100317627-100317649 CTTAGGCTGGAGTGCAGTGATGG + Intronic
1112549009 13:100402561-100402583 ACTAGGCTGGAAGTTCGTGAGGG - Intronic
1112570618 13:100589870-100589892 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1113084557 13:106554840-106554862 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1113282616 13:108806066-108806088 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1114007259 14:18328083-18328105 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1114008187 14:18335236-18335258 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1114010770 14:18364850-18364872 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1114178092 14:20342229-20342251 CCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1114310597 14:21463287-21463309 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1114422383 14:22595549-22595571 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1115352742 14:32413222-32413244 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
1115484162 14:33893590-33893612 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1115894895 14:38075349-38075371 CCTAGGCTGGAGTACAGTGGAGG - Intergenic
1116467406 14:45249829-45249851 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1117220933 14:53604609-53604631 CCCAGGCTGGAGTACAGTGATGG - Intergenic
1117741716 14:58825717-58825739 ACCAGGATGGATCTCAGGGAAGG - Intergenic
1117987822 14:61405773-61405795 AGTAGGTTGGAGCTCAGTCTTGG + Intronic
1117993788 14:61459886-61459908 ACCAGGCTGGAGTGCAGTGACGG + Intronic
1118330393 14:64810635-64810657 CCCAGGCTGGAGCACAGTGGTGG - Intronic
1118421813 14:65614069-65614091 CCCAGGCTGGAGTACAGTGATGG - Intronic
1118787837 14:69061046-69061068 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1118980273 14:70710523-70710545 ACTGCTCTGGAGCTCAGTGAGGG + Intergenic
1119403441 14:74379900-74379922 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1119558286 14:75569958-75569980 ATGAGGCTGGAGCAGAGTGAGGG - Intergenic
1119676032 14:76555392-76555414 CCTAGGCTGGAGTTCAGTGGCGG + Intergenic
1120243567 14:81978952-81978974 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1120550195 14:85861715-85861737 ACTTGGCTGAAGCTCTTTGAGGG + Intergenic
1120638715 14:86983451-86983473 CCCAGGCTGGAGCGCAGTGGTGG - Intergenic
1120695800 14:87643521-87643543 ACTGAGCTGAAGCTAAGTGAGGG + Intergenic
1120913964 14:89694007-89694029 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1120978833 14:90273513-90273535 CCCAGGCTGGAGTGCAGTGACGG - Exonic
1121139822 14:91531544-91531566 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1121190024 14:92018916-92018938 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1121290106 14:92767427-92767449 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1121393830 14:93600155-93600177 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1121940288 14:98063790-98063812 CCCAGGCTGGAGCGCAGTGGTGG - Intergenic
1122390885 14:101382645-101382667 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1122553361 14:102562372-102562394 TCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1122617595 14:103030651-103030673 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1122675727 14:103411663-103411685 GCTAGGCTGGAGTGCAGTGGCGG + Intronic
1122744285 14:103888863-103888885 CCCAGGCTGGAGCCCAGTGGCGG + Intergenic
1122931467 14:104934545-104934567 GCTAGGCTGGAGTTCAGGGATGG + Exonic
1202848482 14_GL000225v1_random:1233-1255 GCTGGGCTGGAGCACAGGGACGG - Intergenic
1202860680 14_GL000225v1_random:79398-79420 GCTGGGCTGGAGCTCGGGGACGG + Intergenic
1123437904 15:20269095-20269117 CCCAGGCTGGAGGGCAGTGATGG - Intergenic
1124824182 15:33077069-33077091 CCTAGGCTGGAGTGCAGTGGGGG + Intronic
1125303128 15:38278868-38278890 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1125457702 15:39877602-39877624 CCTAGGCTGGAGTGCAATGACGG + Intronic
1125652498 15:41329021-41329043 CCCAGGCTGGAGCACAGTGGCGG - Intronic
1125670351 15:41467670-41467692 TCCAGGCTGGAGCGCAGTGGCGG - Intronic
1126160903 15:45612424-45612446 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1126487157 15:49194280-49194302 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1127118723 15:55752899-55752921 CCCAGGCTGGAGCGCAGTGGTGG + Intergenic
1127121534 15:55776245-55776267 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1127964200 15:63911846-63911868 GGTAGCCTGGAGCTCAGGGATGG - Intronic
1128137543 15:65275070-65275092 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1128219653 15:65959163-65959185 ACTAGGTTGCAGCTCCGTGGGGG + Intronic
1128579702 15:68800699-68800721 CCCAGGCTGGAGCGCAGTGGCGG - Intronic
1129386087 15:75196789-75196811 CCCAGCCTGGAGCTCAGGGAAGG + Intronic
1129441620 15:75585113-75585135 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1129449674 15:75644027-75644049 GCTAGGCTGGAGCGCAGTGGCGG + Intronic
1129621058 15:77146130-77146152 ACAAGGCTGCTGCACAGTGATGG - Intronic
1130846643 15:87753840-87753862 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1131387985 15:92023509-92023531 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1131632424 15:94193366-94193388 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1131729579 15:95265540-95265562 ACTAGCTTGGAACTTAGTGAAGG + Intergenic
1132050586 15:98604831-98604853 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
1132542617 16:518119-518141 ACTAGGCTGGAGCGCAGTGGCGG + Intronic
1132783847 16:1643496-1643518 CCCAGGCTGGAGCACAGTGGAGG - Intronic
1133049395 16:3108456-3108478 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1133084755 16:3353446-3353468 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1133193784 16:4153878-4153900 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1133355316 16:5132138-5132160 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1133791971 16:9016042-9016064 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1134158552 16:11864795-11864817 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1134166590 16:11934814-11934836 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1134422431 16:14106791-14106813 ATTGGGCTGGGACTCAGTGAGGG + Intronic
1134494116 16:14718899-14718921 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1134499496 16:14758021-14758043 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1134526046 16:14944646-14944668 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1134546360 16:15111713-15111735 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1134581076 16:15371002-15371024 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1134643795 16:15850340-15850362 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1134713626 16:16343133-16343155 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1134721495 16:16386490-16386512 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1134945931 16:18325390-18325412 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1134953194 16:18365534-18365556 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1135045663 16:19153101-19153123 CCTAGGCTGGAGTACAGTGGTGG + Intronic
1135311982 16:21412224-21412246 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1135364931 16:21844679-21844701 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1135446909 16:22526660-22526682 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1135518029 16:23151411-23151433 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
1135688033 16:24513973-24513995 ACCAGGCTGGAGTTCAGTGGAGG - Intergenic
1135768998 16:25201887-25201909 CCTAGGCTGGAGTTCAGTGGTGG - Intergenic
1136037417 16:27550410-27550432 ACTGGCCGGGAGCTCAGTGAAGG + Intronic
1136137844 16:28268283-28268305 ACTAGGCTGGAGTGCAGTGGTGG + Intergenic
1136151147 16:28350152-28350174 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1136167382 16:28463990-28464012 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1136195595 16:28651025-28651047 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1136211933 16:28765144-28765166 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1136256654 16:29045085-29045107 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1136308683 16:29391222-29391244 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1136322101 16:29492749-29492771 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1136352818 16:29722294-29722316 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1136374965 16:29859960-29859982 CCCAGGCTGGAGTTCAGTGGCGG - Intronic
1136436780 16:30232721-30232743 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
1136846670 16:33581757-33581779 CCCAGGCTGGAGGGCAGTGACGG + Intergenic
1137036501 16:35573983-35574005 GCCTGGCTGGAGCTCCGTGAGGG + Intergenic
1137433031 16:48433733-48433755 GTTAGGCTGGAGGTCAGGGAGGG - Intronic
1138140876 16:54567424-54567446 CCCAGGCTGGAGTTCAGTGGCGG - Intergenic
1138252959 16:55519464-55519486 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1138407454 16:56807978-56808000 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1138427992 16:56949183-56949205 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1138669912 16:58605461-58605483 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1138683397 16:58703878-58703900 ACCAGGCTGGAGTTCAATGATGG + Intergenic
1138835368 16:60428440-60428462 ACTAGGCTGGAAGTCCGAGAAGG - Intergenic
1139708255 16:68757129-68757151 CCCAGGCTGGAGCGCAGTGTTGG + Intronic
1139856387 16:69983654-69983676 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1139995941 16:70979879-70979901 CCCAGGCTGGAGTTCAGTGACGG - Intronic
1140366344 16:74384409-74384431 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1140429087 16:74886133-74886155 ACTAGGTTGGAGTGCAGTGGCGG - Intronic
1140716634 16:77732283-77732305 ACCAGGCTGGAGTGCAGTGATGG - Intronic
1141084944 16:81087106-81087128 CCCAGGCTGGAGTACAGTGATGG + Intronic
1141495581 16:84407301-84407323 ACTAGGCTGGTGCTCTGAGGAGG + Intronic
1141598958 16:85113859-85113881 ACTTGACTGGCGCTCAGCGACGG - Intergenic
1141804619 16:86334619-86334641 CCCAGGGTGGGGCTCAGTGAAGG + Intergenic
1142234811 16:88917029-88917051 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1142324256 16:89403879-89403901 ACCAGGCTGGAGTGCAGTCATGG - Intronic
1203108378 16_KI270728v1_random:1430412-1430434 CCCAGGCTGGAGGGCAGTGACGG + Intergenic
1142637810 17:1268737-1268759 GCCAGGCTGGAGCGCAGTGGCGG + Intergenic
1142822603 17:2482866-2482888 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1142995120 17:3755426-3755448 ACGAGGCAGGAGCCCAGTGTTGG - Intronic
1143028798 17:3955922-3955944 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
1143577631 17:7803887-7803909 ACCAGGCTGGAGCTGAGGGACGG + Intronic
1144315647 17:14058668-14058690 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1144362315 17:14507269-14507291 AAAAGGCTGGAGCTCAGGGTGGG + Intergenic
1144470454 17:15535524-15535546 ATTTGGATGGAGCACAGTGATGG - Intronic
1144897699 17:18554382-18554404 CCCAGGCTGGAGTACAGTGACGG + Intergenic
1144925887 17:18808148-18808170 ATTTGGATGGAGCACAGTGATGG + Intergenic
1145131450 17:20355189-20355211 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1145134673 17:20391336-20391358 CCCAGGCTGGAGTACAGTGACGG - Intergenic
1145792331 17:27635398-27635420 CCCAGGCTGGAGTTCAGTGAGGG - Intronic
1145829465 17:27903817-27903839 CCTAGGCTGGAGTGCAGTGATGG - Intergenic
1145914438 17:28563248-28563270 CCTAGGCTGGAGTACAGTGGCGG - Intronic
1146732945 17:35211593-35211615 CCTAGGCTGGAGTGCAGTGATGG + Intergenic
1146739404 17:35268828-35268850 TCTAGGCTGCAGTTCAGAGAGGG - Exonic
1146762295 17:35489025-35489047 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1146835337 17:36106181-36106203 AAAAGGCTGAAGCTCAGAGAGGG - Intergenic
1147130922 17:38408317-38408339 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1147245290 17:39116298-39116320 TGGAGGCTGGAGCTCAGGGATGG + Intronic
1147291343 17:39445984-39446006 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1147564773 17:41529347-41529369 ATCAGGCTGGAGCTTAGTGTTGG - Intergenic
1147700518 17:42391179-42391201 CCTAGGCTGGAGTGCAGTGGAGG - Intergenic
1147866569 17:43556889-43556911 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
1148166302 17:45486172-45486194 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1148187801 17:45657198-45657220 TCCAGGCTGGAGTGCAGTGATGG + Intergenic
1148887221 17:50782787-50782809 CCCAGGCTGGAGCGCAGTGGTGG + Intergenic
1149770471 17:59316862-59316884 CCTAGGCTGGAGCACAGTGGTGG - Intergenic
1149839234 17:59943829-59943851 CCCAGGCTGGAGTGCAGTGAGGG - Intronic
1149909790 17:60556667-60556689 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
1150090605 17:62321593-62321615 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1150297849 17:64023453-64023475 CCCAGGCTGGAGGACAGTGATGG + Intergenic
1150298533 17:64028932-64028954 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1150676687 17:67250046-67250068 CCTAGGCTGGAGTGCAGTGACGG - Intergenic
1150883533 17:69058794-69058816 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1150982955 17:70164035-70164057 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1151131878 17:71905235-71905257 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1151521983 17:74636744-74636766 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1151539869 17:74759402-74759424 ACTGGGCTGAAGATCAGTAAGGG + Intronic
1151638081 17:75366767-75366789 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1152037296 17:77881199-77881221 GGGAGGCTGGAGCTCAGGGACGG - Intergenic
1152172741 17:78764066-78764088 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1153166637 18:2269136-2269158 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1153282544 18:3427640-3427662 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1153294222 18:3530362-3530384 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1153460572 18:5328344-5328366 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
1153527833 18:6014645-6014667 ACATGGCTGGAGCTCAGAGTGGG + Intronic
1154117861 18:11626920-11626942 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1154159291 18:11968952-11968974 CCCAGGCTGGAGTCCAGTGATGG + Intergenic
1154235908 18:12605461-12605483 ACCAGGCTGGAGGGCAGTGGCGG - Intronic
1154529269 18:15328716-15328738 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1154939268 18:21094704-21094726 CCCAGGCTGGAGTTCAGTGGTGG - Intronic
1155384240 18:25259800-25259822 CCTAGACTGGGGCTCAGTGAAGG + Intronic
1155955306 18:31951880-31951902 GCCAGGCTGGAGTTCAGTGGCGG - Intronic
1156226761 18:35117269-35117291 GGCAGGCTGGAGCTCAGGGAAGG - Intronic
1156269863 18:35520751-35520773 CCCAGGCTGGAGCACAGTGGGGG - Intergenic
1157665627 18:49484543-49484565 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1158039650 18:53077326-53077348 GCTACACTGCAGCTCAGTGAGGG - Intronic
1158805766 18:60970247-60970269 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1158984796 18:62802940-62802962 ACCAGGGAGAAGCTCAGTGAGGG + Intronic
1159351539 18:67281405-67281427 CCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1159552270 18:69907357-69907379 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1159906065 18:74093365-74093387 ACTCTGCTGGAGCTCTCTGATGG + Intronic
1160905400 19:1449666-1449688 TCCAGGCTGGAGCTCCCTGAGGG - Intronic
1161033674 19:2072134-2072156 ACCAGGCTGGAGTGCAGTGGTGG - Exonic
1162047201 19:8007971-8007993 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1162285763 19:9737567-9737589 CCCAGGCTGGAGCTCAGTGGTGG + Intergenic
1162385138 19:10356551-10356573 ACTGGGATGGAGCTCACTGTGGG + Exonic
1162533603 19:11250354-11250376 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1162624156 19:11870557-11870579 ACTAGGCTGGAGTGCAATGATGG - Intronic
1162881764 19:13665084-13665106 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
1163036679 19:14573478-14573500 CCTAGGCTGGAGTGCAGTGATGG - Intergenic
1163058210 19:14738419-14738441 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1163474903 19:17520108-17520130 TCCAGGCTGGAGTACAGTGACGG - Intronic
1163511511 19:17738277-17738299 CCCAGGCTGGATCTCAGTGACGG - Intergenic
1163557057 19:17998858-17998880 TCTGGGCTGGAGCTCAGTGAGGG + Exonic
1164503375 19:28838150-28838172 ACTAGACAGAAGCCCAGTGAGGG - Intergenic
1164529063 19:29033965-29033987 ACCAGGCTGGAGTGCAGTGGGGG + Intergenic
1164636274 19:29793627-29793649 GGAAGGCTGGAGCACAGTGACGG - Intergenic
1165525525 19:36351454-36351476 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1165679706 19:37763519-37763541 CCCAGGCTGGAGTACAGTGATGG - Intronic
1165834676 19:38746889-38746911 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1165911025 19:39227610-39227632 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1165986189 19:39770936-39770958 TCCAGGCTGGAGTGCAGTGAGGG + Intergenic
1166025709 19:40082630-40082652 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1166170241 19:41023331-41023353 ACTAGGCTACACCTCAGAGAGGG + Intergenic
1166289035 19:41850035-41850057 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1166334368 19:42096283-42096305 ACCAGGATGGGGCTCAGCGATGG + Intronic
1166349621 19:42189770-42189792 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1166591274 19:44001801-44001823 CCTAGGCTGGAGGGCAGTGGTGG + Intergenic
1166609849 19:44181337-44181359 ACCAGGCTGCAGTTCAGTGTTGG - Intergenic
1166791395 19:45400817-45400839 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
1166947755 19:46407433-46407455 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1167073972 19:47237729-47237751 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1167150847 19:47708626-47708648 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1167296407 19:48652893-48652915 CCCAGGCTGGAGCACAGTGGTGG + Intergenic
1167341621 19:48919809-48919831 CGTAGGCTGGAGCCCAGTGGTGG + Intronic
1168007796 19:53505373-53505395 ACGAGGCTGGAGCCCAGGGCGGG - Intergenic
1168060074 19:53886443-53886465 CCTAGACTGGAGTACAGTGATGG + Intronic
1168177968 19:54638364-54638386 ACCAGGCTGGAGCGCAGGGGCGG - Intronic
1168447629 19:56434958-56434980 CCTAGGCTGGAGTGCAGTGCCGG - Intronic
1168466358 19:56605007-56605029 TCTAGGCTGGAGCTGAGTGGTGG - Intronic
1168622265 19:57888906-57888928 GCTACTCTGGAGCTCTGTGACGG - Exonic
1168645178 19:58054957-58054979 GCTAGGCTGGAGCAGAGTGTGGG + Intergenic
924994796 2:349451-349473 CCTAGGCTGGAGGGCAGTGGTGG - Intergenic
925236648 2:2284746-2284768 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
925288207 2:2729613-2729635 ACTGGGCAGGAGCTCTGTGCAGG + Intergenic
927345022 2:22028016-22028038 ACTGGTGTGGAGCTCAGAGAAGG + Intergenic
928427961 2:31194183-31194205 ACTAGGGTGGAGCTCAGCGAGGG - Intronic
928519458 2:32074546-32074568 CCCAGGCTGGAGTTCAGTGGGGG + Intronic
928973581 2:37059504-37059526 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
929265638 2:39916184-39916206 CCCAGGCTGGAGGGCAGTGATGG + Intergenic
929465554 2:42140819-42140841 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
929995585 2:46824281-46824303 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
930005020 2:46889731-46889753 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
930305007 2:49666337-49666359 CCTAGGATGGAGCTCACAGAGGG - Intergenic
930657865 2:54024321-54024343 CCCAGGCTGGAGTACAGTGACGG - Intronic
931327299 2:61239966-61239988 CCCAGGCTGGAGTGCAGTGACGG - Intronic
931369894 2:61652244-61652266 CCTAGGCTGGAGTACAGTGGTGG - Intergenic
931731589 2:65158259-65158281 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
932165475 2:69501926-69501948 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
932387088 2:71345434-71345456 CCTAGGCTGGAGTACAGTGGTGG + Intronic
933253500 2:80055067-80055089 TCCAGGCTGGAGTGCAGTGATGG + Intronic
933754986 2:85631356-85631378 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
934057632 2:88265317-88265339 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
934623309 2:95829608-95829630 TCTTGGCTGGAGCTCCCTGATGG - Intergenic
934688567 2:96339546-96339568 CCCAGGCTGGAGTGCAGTGACGG - Intronic
934737432 2:96696860-96696882 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
934810451 2:97272483-97272505 TCTGGGCTGGAGCTCCCTGATGG + Intergenic
934827241 2:97435456-97435478 TCTGGGCTGGAGCTCCCTGATGG - Intergenic
934870171 2:97857266-97857288 ACTGGGCTGGAGCCCGGTGGGGG + Intronic
935008907 2:99112696-99112718 GCATGGCTGGAGCACAGTGAGGG + Intronic
935225613 2:101049867-101049889 CCCAGGCTGGAGTGCAGTGACGG + Intronic
935354996 2:102189657-102189679 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
935730911 2:106064632-106064654 CCCAGGCTGGAGTGCAGTGATGG - Intronic
936537216 2:113321692-113321714 ACTAGACTGGGGTTCTGTGAGGG + Intergenic
936914121 2:117622748-117622770 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
937284901 2:120744091-120744113 TCGAGGCTGAAGATCAGTGAAGG + Intronic
937844816 2:126567727-126567749 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
937884486 2:126890515-126890537 TCTAGGCTGGAGCTTTGTGTGGG + Intergenic
938867888 2:135443071-135443093 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
938988595 2:136604874-136604896 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
939560099 2:143721727-143721749 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
939840132 2:147177353-147177375 GCTAGGGTGGGGTTCAGTGAGGG - Intergenic
939902627 2:147868672-147868694 CCCAGGCTGGAGTGCAGTGACGG + Intronic
940228852 2:151429221-151429243 CCCAGGCTGGAGTGCAGTGATGG + Intronic
940461246 2:153966406-153966428 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
940686535 2:156857600-156857622 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
941000785 2:160201865-160201887 TCTAGGCTGGAGGGCAGTGCAGG + Intronic
941989868 2:171545094-171545116 CCCAGGCTGGAGTTCAGTGGTGG - Intronic
944576054 2:201092094-201092116 CCTAGGCTGGAGTGCAGTGGAGG - Intergenic
944620903 2:201515275-201515297 CCCAGGCTGGAGCACAGTGGTGG + Intronic
944743371 2:202633766-202633788 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
944748845 2:202686763-202686785 TCCAGGCTGGAGTTCAGTGATGG - Intronic
944842721 2:203639892-203639914 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
944997021 2:205304900-205304922 CCCAGGCTGGAGTCCAGTGAAGG - Intronic
946012080 2:216573395-216573417 ACTAGGCTGGCGGCCAATGAGGG + Intronic
946932863 2:224688649-224688671 CCCAGGCTGGAGTGCAGTGAGGG + Intergenic
947583610 2:231337510-231337532 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
947609754 2:231517034-231517056 CCTAGGTTGGAGCACAGTGGTGG - Intergenic
948178829 2:235964356-235964378 ACTAGGGTTGAGCTCTCTGAGGG + Intronic
948273932 2:236694195-236694217 CCCAAGCAGGAGCTCAGTGACGG - Intergenic
948914244 2:241023930-241023952 CCCAGGCTGGAGTGCAGTGACGG + Intronic
949048224 2:241881979-241882001 ACTTGGCTGGGCCCCAGTGAAGG - Intergenic
1169807067 20:9570577-9570599 ACTAATCTGGAGCTTATTGAAGG - Intronic
1169812110 20:9618963-9618985 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1170288653 20:14742807-14742829 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1170559095 20:17540552-17540574 ACTAGACTGCAGCTCTTTGAGGG + Intronic
1170991667 20:21306961-21306983 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1172070220 20:32251318-32251340 CCTAGACTGGAGTGCAGTGATGG + Intergenic
1172329763 20:34067235-34067257 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1172696220 20:36824980-36825002 CCTAGGCTGGAGTGCAATGATGG + Intronic
1172720428 20:36995727-36995749 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1172792274 20:37514010-37514032 AACAGGCTGGAGCTTAGTAAAGG + Intronic
1172990323 20:39031374-39031396 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1173061666 20:39667417-39667439 ACCAGGCTGGAGTACAGTGGCGG - Intergenic
1173107294 20:40150031-40150053 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1173626617 20:44477472-44477494 ACCTGGCTGGGGGTCAGTGAAGG + Intronic
1173912127 20:46678179-46678201 AATAGGCTGGGTCTCAGTGCCGG + Intronic
1174267475 20:49342242-49342264 CCCAGGCTGGAGCGCAGTGGTGG - Intergenic
1174544985 20:51318476-51318498 CCTGGGCTGGAGCTGACTGAAGG - Intergenic
1174813093 20:53663985-53664007 ACCAGGCTGGAGTACAGTGGTGG - Intergenic
1174850133 20:53986040-53986062 ACTAGGCTGGAACTTGGTGAAGG + Intronic
1176768130 21:13039763-13039785 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1177264092 21:18761901-18761923 CCTAGGCTGGAGTGCAGTGTTGG - Intergenic
1177574149 21:22928751-22928773 CCCAGGCTGGAGTTCAGTGGCGG - Intergenic
1177575360 21:22948063-22948085 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1177896840 21:26863344-26863366 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1178023095 21:28432421-28432443 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
1178257880 21:31071715-31071737 TCTAGGCTGGAGTGCAGTGGGGG - Intergenic
1178325889 21:31645335-31645357 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1178472671 21:32907372-32907394 AATAGGCAGGAGCCCAGTGGTGG + Intergenic
1178826033 21:36017686-36017708 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1178850248 21:36207225-36207247 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1179554789 21:42165567-42165589 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1180005125 21:45017214-45017236 ACAAGGATGGTGCACAGTGATGG - Intergenic
1180300858 22:11035482-11035504 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
1180431766 22:15258890-15258912 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1180432693 22:15266053-15266075 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1180435264 22:15295656-15295678 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1180658730 22:17447075-17447097 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1180998753 22:19978210-19978232 CACAGTCTGGAGCTCAGTGAAGG + Intronic
1181114260 22:20621290-20621312 CCTGGGCTGGAGGACAGTGAGGG + Intergenic
1182370797 22:29809077-29809099 CCCAGGCTGGAGTTCAGTGGGGG - Intronic
1182429543 22:30291725-30291747 CCAGGGCTGGAGCTCAGTGCTGG - Intronic
1182759817 22:32713419-32713441 AATATGCTGGAGCCCACTGAAGG - Intronic
1182994365 22:34799224-34799246 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1183287146 22:36974071-36974093 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1183312303 22:37117088-37117110 TCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1183416561 22:37685984-37686006 TCCAGGCTGGAGTTCAGTGGCGG - Intronic
1183491457 22:38118794-38118816 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1183626277 22:39004292-39004314 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1183886009 22:40882699-40882721 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1184524805 22:45015651-45015673 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1184622817 22:45695280-45695302 CCCAGGCTGGAGTTCAGTGGCGG - Intronic
1184666648 22:45992781-45992803 CCAGGGCTGGAGCTCAGTGCAGG - Intergenic
949415179 3:3806224-3806246 ACTAGACTGAAGCTCACTGAGGG - Intronic
950497726 3:13344089-13344111 CCAAGGCTGGAGTGCAGTGACGG + Intronic
950575713 3:13830912-13830934 ACAAAGCTGGAGCTCAAGGAGGG - Intronic
950662733 3:14476773-14476795 ACGAGGATGGAGATCAGTGAGGG + Intronic
950731838 3:14966543-14966565 TCCAGGCTGGAGTGCAGTGAGGG - Intronic
951855171 3:27187896-27187918 AGTAGGCTGGAGCTAGATGATGG - Intronic
951893033 3:27584560-27584582 CCTAGGCTGGAGTACAGTGGCGG + Intergenic
952257295 3:31706398-31706420 AAGAGGCTGGAGGTCAGCGAAGG - Intronic
952927090 3:38328220-38328242 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
953651913 3:44813667-44813689 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
954009626 3:47624246-47624268 ACTAGGCTGGAGTACAGTGGAGG - Intronic
954186399 3:48920019-48920041 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
954269452 3:49496213-49496235 CCCAGGCTGGAGCACAGTGGTGG + Intronic
954423136 3:50429185-50429207 CCCAGGCTGGAGCGCAGTGGTGG - Intronic
954587094 3:51745543-51745565 ACTTACCTGGGGCTCAGTGAGGG - Intergenic
954980594 3:54741919-54741941 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
954988242 3:54814555-54814577 ACCAGGCTGGACCTCTCTGAAGG - Intronic
955265886 3:57444314-57444336 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
956118437 3:65941832-65941854 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
956341094 3:68224949-68224971 CCTAGGCTGGAGTACAGTGGTGG + Intronic
956439512 3:69266157-69266179 CCCAGGCTGGAGTGCAGTGATGG - Intronic
956499828 3:69870475-69870497 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
957185349 3:76934698-76934720 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
957358224 3:79118820-79118842 ACCAGGCTGGAGTACAGTGGTGG - Intronic
957636888 3:82798102-82798124 TCTAGTCTGGAGCCCAGTGGAGG - Intergenic
959072854 3:101719241-101719263 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
959451606 3:106510513-106510535 CCCAGGCTGGAGTTCAGTGGCGG - Intergenic
959483217 3:106898569-106898591 AGTACACTGGAGCTCAGGGAGGG - Intergenic
961294294 3:125871943-125871965 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
961891669 3:130135533-130135555 TCTAGGCTGGAGTGCAGTGGTGG + Intergenic
962550560 3:136486348-136486370 ACAAAGCTGTAGCTCAGAGATGG - Intronic
962782697 3:138735563-138735585 ACTTGCCTAGAGCTCTGTGATGG - Intronic
964513705 3:157482264-157482286 CCCAGGCTGGAGTGCAGTGATGG + Intronic
964520754 3:157563885-157563907 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
964937044 3:162102537-162102559 CCTAGGCTGCAGTGCAGTGATGG - Intergenic
965156429 3:165064025-165064047 CCTAGGCTGGAGTGCAGTGAGGG - Intronic
966290815 3:178356209-178356231 TCTAGTCTGGAGCTTTGTGAAGG + Intergenic
967640023 3:191851263-191851285 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
967846776 3:194049969-194049991 AGTAGACTGAAGCTTAGTGAGGG - Intergenic
968168983 3:196493395-196493417 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
968340963 3:197955309-197955331 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
968348650 3:198033457-198033479 CCCAGGCTGGAGTGCAGTGATGG + Intronic
968352247 3:198068152-198068174 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
968817279 4:2828635-2828657 ACTGGGCTGCAGCTCAGGGCTGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
968888162 4:3347399-3347421 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
969750959 4:9110553-9110575 TCTAGGCTGGAGTGCAGTGGTGG - Intergenic
970055713 4:11969800-11969822 ACTAATCTATAGCTCAGTGAAGG + Intergenic
970501487 4:16681667-16681689 CCCAGGCTGGAGTGCAGTGATGG + Intronic
970761903 4:19499873-19499895 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG + Intronic
971309584 4:25513917-25513939 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
972669061 4:41196114-41196136 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
972734131 4:41823658-41823680 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
973130547 4:46643073-46643095 CCCAGGCTGGAGCCCAGTGGCGG + Intergenic
973548344 4:52005248-52005270 ATTTGGCTGGAGCTGAATGAAGG + Intronic
973807301 4:54538770-54538792 CCCAGGCTGGAGTGCAGTGACGG + Intergenic
973959355 4:56094469-56094491 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
974054306 4:56970251-56970273 TCTAGGCTGGAGTGCAGTGGTGG - Intronic
974379740 4:61123766-61123788 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
975132257 4:70841239-70841261 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
975318243 4:72979585-72979607 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
976086689 4:81414027-81414049 ACTAGTCTGAAGTTCAGGGAAGG + Intergenic
976763257 4:88572381-88572403 CCCAGGCTGGAGTGCAGTGATGG - Intronic
977261657 4:94803919-94803941 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
977581403 4:98729024-98729046 TCTAGGATGAAGCTCAGGGAAGG + Intergenic
977589983 4:98815158-98815180 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
977834823 4:101635057-101635079 ACTTACCTGGGGCTCAGTGAGGG + Intronic
978240426 4:106508839-106508861 TCTAGGCTGGAGTGCAGTGGTGG + Intergenic
978570309 4:110129939-110129961 ACCAGGCTGGAGTGCAGTAATGG + Intronic
978824213 4:113001286-113001308 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
980062640 4:128148670-128148692 CCCAGGCTGGAGCACAGTGGCGG + Intronic
980118330 4:128703074-128703096 CCCAGGCTGGAGTTCAGTGATGG + Intergenic
981074851 4:140580634-140580656 CCCAGGCTGGAGTTCAGTGGCGG - Intergenic
981183918 4:141779415-141779437 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
981264823 4:142769869-142769891 CCCAGGCTGGAGCACAGTGGTGG - Intronic
981942267 4:150294906-150294928 ACCAGGCTGGAGTGCAGTGGTGG - Intronic
982027414 4:151264383-151264405 CCCAGGCTGGAGAGCAGTGACGG - Intronic
982030189 4:151293075-151293097 CCCAGGCTGGAGTGCAGTGATGG - Intronic
982136935 4:152281124-152281146 ACTACTCTGGAGCTCACTGTGGG - Intergenic
982591478 4:157317931-157317953 ACTAGGCTGGAGTACAATGGTGG - Intronic
983237316 4:165194160-165194182 ATGTGGCTGGAGCACAGTGAAGG - Intronic
983500659 4:168495677-168495699 CCCAGGCTGGAGTGCAGTGATGG + Intronic
983506277 4:168557084-168557106 CCCAGGCTGGAGTGCAGTGACGG + Intronic
983521568 4:168715038-168715060 ACTCGGCTGGAGGTCTGGGATGG - Intronic
983673207 4:170261981-170262003 ATTATGCTGCAGCTCAGGGAGGG - Intergenic
985112946 4:186564651-186564673 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
985284612 4:188322710-188322732 ACTCGGTTGGAGCTCGGGGAAGG + Intergenic
985295202 4:188430500-188430522 ACTTGGCTGGAGCTCTGAGAGGG - Intergenic
986039100 5:3969612-3969634 AATATGCTGGAGCTCTGTCATGG - Intergenic
986842564 5:11714868-11714890 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
987372531 5:17206706-17206728 CCCAGGCTGGAGTGCAGTGATGG - Intronic
987692908 5:21291832-21291854 CCCAGGCTGGAGCGCAGTGGCGG + Intergenic
988509312 5:31852637-31852659 CCCAGGCTGGAGTGCAGTGATGG + Intronic
988791247 5:34609870-34609892 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
989470626 5:41813497-41813519 TCTAGGCTGGAGCTAGGGGATGG - Intronic
989528075 5:42475945-42475967 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
990007449 5:50960584-50960606 CCCAGGCTGGAGCACAGTGGCGG + Intergenic
990008968 5:50972729-50972751 CCCAGGCTGGAGCACAGTGGTGG + Intergenic
990457843 5:56005228-56005250 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
990586813 5:57219331-57219353 CCCAGGCTGGAGTTCAGTGGCGG - Intronic
991028081 5:62052300-62052322 ACTCTGCTGGAGCTCTCTGATGG + Intergenic
991114267 5:62935907-62935929 ACTGTGCTGGAGCTCAGAGAAGG + Intergenic
992017945 5:72594773-72594795 ACTAGGCTGGAAGTCCCTGAGGG - Intergenic
992081618 5:73239050-73239072 GCAAGGCTGGAGCGAAGTGATGG + Intergenic
992261753 5:74977666-74977688 ACTTGGCTGAAGCTCAAGGAGGG - Intergenic
992479081 5:77132629-77132651 ACTAGTCTGGAGCAGAGGGATGG - Intergenic
992662834 5:78978286-78978308 CCCAGGCTGGAGCACAGTGTTGG - Intronic
993561996 5:89421563-89421585 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
993571114 5:89540162-89540184 ACTAAGCATGAGTTCAGTGAAGG + Intergenic
993599446 5:89902629-89902651 GCTAGGCTGGAGTGCAGTGGCGG + Intergenic
994315829 5:98332085-98332107 CCCAGGCTGGAGCACAGTGGCGG + Intergenic
995225355 5:109694381-109694403 TCCAGGCTGGAGTGCAGTGATGG + Intronic
996065365 5:119073103-119073125 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
996112623 5:119583332-119583354 ACTAGGCTGGAGAACAAAGAGGG - Intronic
996616887 5:125452626-125452648 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
996730470 5:126712831-126712853 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
996734186 5:126743533-126743555 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
997298516 5:132784998-132785020 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
997312604 5:132900515-132900537 CCTAGGCTGGAGTGCAGTGATGG - Intronic
997574213 5:134961326-134961348 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
997960663 5:138318268-138318290 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
998017088 5:138740934-138740956 CCCAGGCTGGAGTGCAGTGACGG + Intronic
998078726 5:139257365-139257387 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
998222097 5:140291546-140291568 ACAAGTCTGGAGTTCAGAGAAGG + Intronic
998476854 5:142429231-142429253 ACTATCCTGGAGGTCAGGGAAGG + Intergenic
998517851 5:142771398-142771420 ACTAGGCTGGAGCTGCGTACAGG - Intronic
1000013751 5:157258581-157258603 CCCAGGCTGGAGCACAGTGGCGG - Intergenic
1000643396 5:163732376-163732398 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1000713262 5:164607039-164607061 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1001167898 5:169387741-169387763 AATGTGCTGGAGCTCAGTGCAGG + Intergenic
1001978131 5:176017733-176017755 CCTAGGCTGGAGCACAGTGGAGG + Intronic
1002239288 5:177826029-177826051 CCTAGGCTGGAGCACAGTGGAGG - Intergenic
1002458986 5:179363357-179363379 ACTAGTCACGAGATCAGTGAGGG + Intergenic
1002489510 5:179564460-179564482 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1002593076 5:180304505-180304527 CCTAGCCTGGAGCTCAGGGGAGG - Intronic
1002720166 5:181254415-181254437 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1002879530 6:1238704-1238726 ACTAGGGTGGGGCACAGGGAGGG - Intergenic
1003315586 6:5008614-5008636 ACTGGAGTGGAGATCAGTGAAGG + Intergenic
1003377154 6:5590163-5590185 ACTGGACTGGATCTCAGTGCAGG + Intronic
1004385903 6:15172542-15172564 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1004411416 6:15384630-15384652 CCTAGGCTGGAGTGCAGTGGGGG + Intronic
1004642042 6:17524934-17524956 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
1004767610 6:18748257-18748279 ACCAAACTGAAGCTCAGTGATGG - Intergenic
1004933906 6:20488948-20488970 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1006044514 6:31283365-31283387 CCTGGGCTGGAGCCCAGTGGTGG - Intronic
1006101950 6:31690964-31690986 ATAAGACTGGAGCTCAGAGAGGG - Intronic
1006684508 6:35821259-35821281 CCCAGGCTGGAGTCCAGTGATGG - Intronic
1007015037 6:38457110-38457132 TCCTGGCTGGAGCTCAGTCATGG + Intronic
1007274789 6:40665410-40665432 ACAAGGCTGCAGCTTAGAGATGG - Intergenic
1007567411 6:42863090-42863112 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
1007569674 6:42880553-42880575 CCCAGGCTGGAGCGCAGTGTCGG + Intronic
1007612091 6:43156564-43156586 CCCAGGCTGGAGTACAGTGATGG - Intronic
1008570296 6:52810528-52810550 ACCAGGCTGGAGTGCAGTGGGGG + Intergenic
1008606785 6:53147996-53148018 ACTAGGTTGTAGCTCAGTATGGG - Intronic
1008692705 6:53999038-53999060 AGTAAGCTGGAGCTGAGTAAGGG + Intronic
1008743397 6:54637967-54637989 ACTATACTGTAGATCAGTGATGG + Intergenic
1009317515 6:62239726-62239748 CCTAGGCTGGAGTGCAGTGGCGG + Intronic
1010068245 6:71711136-71711158 CCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1010120782 6:72373955-72373977 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1012522432 6:100137115-100137137 TCCAGGCTGGAGCGCAGTGGCGG + Intergenic
1012935982 6:105367627-105367649 CCCAGGCTGGAGCGCAGTGGCGG - Intronic
1013065031 6:106675942-106675964 ACAAGGCTGGATCACAGTGTTGG - Intergenic
1013136313 6:107286093-107286115 TCTAGGCTGGAGCCTAGTCAAGG + Intronic
1013189822 6:107792687-107792709 ACCAGGCTGGAGCGCAGTGGTGG - Intronic
1014720462 6:124911577-124911599 ACCAGGCTGGAGTGCAGTGGAGG - Intergenic
1015197181 6:130536799-130536821 CCTAGGCTGGAGCTCCCAGAGGG + Intergenic
1015244837 6:131063593-131063615 TCTAGGAAGGCGCTCAGTGAAGG - Intergenic
1015490339 6:133817817-133817839 CCCAGGCTGGAGCACAGTGGGGG - Intergenic
1017699280 6:157052760-157052782 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1017890877 6:158638465-158638487 CCCAGGCTGGAGAGCAGTGATGG + Intronic
1017923473 6:158890797-158890819 ACTAGGCTGGAGTACAGTAGTGG - Intronic
1018092724 6:160358904-160358926 ACTAGACCAGAGCTCAGTGAGGG + Intronic
1018282963 6:162207327-162207349 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1018512303 6:164538274-164538296 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018776188 6:167018430-167018452 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1019188853 6:170238392-170238414 ACAGGGCTGGAGCTCAGGGCAGG + Intergenic
1019819912 7:3234664-3234686 CCCAGGCTGGAGCACAGTGGTGG - Intergenic
1019883537 7:3884296-3884318 ACTAGACTGAGGCTCAGTGAGGG + Intronic
1020126839 7:5537742-5537764 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1020223448 7:6260421-6260443 GAGTGGCTGGAGCTCAGTGAGGG - Intronic
1020253230 7:6485689-6485711 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1020322013 7:6946090-6946112 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1020444132 7:8250604-8250626 CCCAGGCTGGAGTGCAGTGAGGG - Intronic
1020801380 7:12737066-12737088 ACCAGGCTGGAGGGCAGTGGCGG + Intergenic
1020948238 7:14643296-14643318 ACTAGGCTCGGGGTCTGTGAGGG - Intronic
1021295826 7:18904939-18904961 CCCAGGCTGGAGTTCAGTGGCGG + Intronic
1021506059 7:21386275-21386297 ACTAGGCTGGAGTGCAGTGGTGG - Intergenic
1021839888 7:24713911-24713933 CCTAGGCTGGAGTGCAGTGGCGG - Intronic
1022006709 7:26272197-26272219 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1022254676 7:28644033-28644055 TCCAGGCTGGAGTACAGTGAGGG - Intronic
1023153511 7:37224673-37224695 ACCAGCTTGGAGTTCAGTGAGGG + Intronic
1023222941 7:37939019-37939041 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1024650518 7:51399376-51399398 TCCAGGCTGGAGTGCAGTGATGG - Intergenic
1025036028 7:55592958-55592980 TGAAGGCTGGAGCTCAGTGGGGG - Intergenic
1025528653 7:61848017-61848039 CCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1026717368 7:72801284-72801306 CCCAGGCTGGAGCGCAGTGGTGG - Intronic
1026739289 7:72968826-72968848 CCCAGGCTGGAGTTCAGTGATGG - Intronic
1026790316 7:73327441-73327463 CCCAGGCTGGAGTTCAGTGATGG - Intronic
1026909159 7:74082735-74082757 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1027104442 7:75396247-75396269 CCCAGGCTGGAGTTCAGTGATGG + Intronic
1027153384 7:75749277-75749299 ACAAGGGTGGTGCTCAGTAACGG + Intergenic
1027160295 7:75797436-75797458 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1027435888 7:78164001-78164023 AGTTGGCTGGAGCTCAGTGATGG + Intronic
1027702493 7:81485972-81485994 CCAAGGCTGGAGCGCAGTGGTGG + Intergenic
1027885926 7:83904668-83904690 ATTAGGCTAGAGCTGAATGATGG - Intergenic
1028907197 7:96168055-96168077 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1028977311 7:96928623-96928645 ACTAGGATGAAGCTCTATGAGGG - Intergenic
1029030198 7:97459079-97459101 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1029141069 7:98410707-98410729 CCCAGGCTGGAGCGCAGTGGTGG + Intergenic
1029261799 7:99307769-99307791 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1030152878 7:106424210-106424232 TCTATGCTGGAGCACAGTGGAGG + Intergenic
1030186559 7:106768112-106768134 AATTGGCTGAAGCTCAGTGATGG - Intergenic
1030307931 7:108038197-108038219 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1030857596 7:114580536-114580558 CCCAGGCTGGAGCACAGTGGTGG - Intronic
1030913716 7:115285531-115285553 CATAGGCTGGAGCAGAGTGAAGG + Intergenic
1031274215 7:119697458-119697480 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1032105190 7:129022418-129022440 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1032120412 7:129151167-129151189 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1032166747 7:129551289-129551311 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1033117568 7:138639210-138639232 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1033121734 7:138672401-138672423 ACTAGGAGGGAGCTGTGTGAAGG + Intronic
1033338257 7:140471510-140471532 CCCAGGCTGGAGCGCAGTGGCGG + Intronic
1033415855 7:141160744-141160766 ACTGAGCTTGTGCTCAGTGATGG + Intronic
1033991923 7:147298379-147298401 CCTAGGCTGGAGTGCAATGACGG - Intronic
1034124303 7:148657141-148657163 CCCAGGCTGGAGTGCAGTGAAGG - Intergenic
1034126874 7:148680295-148680317 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1034507996 7:151510566-151510588 ACTAGACTGAAGCTCCTTGAGGG + Intronic
1035357467 7:158285190-158285212 TCTGGGCAGGAGCGCAGTGAAGG - Intronic
1036136417 8:6165691-6165713 ACCAGGCTGGAGCACACTTAGGG - Intergenic
1036186347 8:6625739-6625761 CCTAGGCTGGAGTACAGTGGTGG - Intronic
1036374163 8:8185953-8185975 TCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1036473315 8:9070443-9070465 CCCAGGCTGGAGTTCAGTGGTGG - Intronic
1036692253 8:10951379-10951401 GCCAGGCTGCAGCTCAGAGAGGG + Intronic
1036876740 8:12479686-12479708 TCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1037318126 8:17618098-17618120 CCTAGGCTGGAGTACAGTGGTGG + Intronic
1037956814 8:23066852-23066874 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1038212406 8:25531581-25531603 CCCAGGCTGGAGTACAGTGATGG - Intergenic
1038346054 8:26733544-26733566 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1038645150 8:29354827-29354849 CCCAGGCTGGAGTGCAGTGAGGG - Intergenic
1038669411 8:29570491-29570513 CCCAGGCTGGAGCGCAGTGGTGG + Intergenic
1039514491 8:38120455-38120477 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1039615648 8:38952992-38953014 CCCAGGCTGGAGCACAGTGGTGG + Intronic
1039956904 8:42214752-42214774 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1039987097 8:42456964-42456986 ACGAGGCTGGAGTGCAGTGGCGG + Intronic
1040029902 8:42814648-42814670 ACCGGGCTGGAGCTGAGTGAGGG - Intergenic
1040058309 8:43081605-43081627 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1040121978 8:43693773-43693795 TCCAGGCTGGAGTGCAGTGATGG - Intergenic
1040416109 8:47197468-47197490 ACTTGGCTGGAGGGCAGAGAGGG - Intergenic
1040666619 8:49641616-49641638 CCCAGGCTGGAGTTCAGTGGTGG + Intergenic
1041262113 8:56030319-56030341 CCCAGGCTGGAGCGCAGTGGTGG - Intergenic
1041800986 8:61798617-61798639 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1042594696 8:70434609-70434631 CCTAGGCTGGAGCTCAGTGATGG + Intergenic
1042772002 8:72391175-72391197 ACTCAGCCGGGGCTCAGTGAGGG - Intergenic
1044005348 8:86931287-86931309 ACTTACCTGGGGCTCAGTGAGGG + Intronic
1044461039 8:92444334-92444356 CCCAGGCTGGAGTTCAGTGGCGG + Intergenic
1044702410 8:94976458-94976480 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1045002886 8:97893617-97893639 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1045630856 8:104119732-104119754 ACCAGGCTGACGCTCCGTGAGGG + Intronic
1045723454 8:105141492-105141514 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1045863615 8:106840183-106840205 AATAAGCTGGAGTACAGTGAGGG - Intergenic
1046598406 8:116288469-116288491 ACTAGACAGGAACTCAGAGAGGG + Intergenic
1046717684 8:117585380-117585402 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1047343669 8:124006634-124006656 ACTAGGCTGGAGCTCCGGAATGG + Intronic
1047888500 8:129279821-129279843 CCTAGGCTGGAGTTCACTGGTGG + Intergenic
1048027975 8:130604234-130604256 ACCAGGCTGGAGTGCAATGATGG - Intergenic
1048552755 8:135448862-135448884 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1049023254 8:139971870-139971892 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1049234987 8:141507946-141507968 ATTGGGGTGGAGCTCAGAGAGGG + Intergenic
1049706939 8:144047406-144047428 ACTAGGCCGGGGCTGGGTGAGGG + Intergenic
1049816771 8:144607191-144607213 CCCAGGCTGGAGCGCAGTGGCGG - Intergenic
1050903130 9:10970475-10970497 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1051805109 9:20983527-20983549 ACCAGGCTGGAGTACAGTGGTGG - Intronic
1053003701 9:34591174-34591196 CATGGGCTGGAGCTCAGAGACGG + Intergenic
1053087718 9:35241012-35241034 CCTAGGCTGGAGAGCAGTGGTGG - Intronic
1053434243 9:38065062-38065084 CCTAGGCTGGAGTGCAGTTATGG - Intronic
1053706985 9:40766479-40766501 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1053884873 9:42636504-42636526 CCCAGGCTGGAGGTCAGTGGCGG - Intergenic
1054223895 9:62443955-62443977 CCCAGGCTGGAGGTCAGTGGCGG - Intergenic
1054416899 9:64887247-64887269 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1056890907 9:90491118-90491140 CCTAGGTTGGAGTCCAGTGATGG - Intergenic
1056967435 9:91177031-91177053 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1057025039 9:91728471-91728493 CCTAGGCTGGAGGGCAGTGGTGG + Intronic
1057113087 9:92492841-92492863 ATGATGCTGGGGCTCAGTGAGGG - Intronic
1057207363 9:93181647-93181669 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1057459493 9:95246854-95246876 AGCAGACAGGAGCTCAGTGAAGG + Intronic
1058540930 9:106011812-106011834 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1058584755 9:106494936-106494958 CCCAGGCTGGAGCGCAGTGGCGG + Intergenic
1059191230 9:112328748-112328770 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1059738713 9:117128328-117128350 ACCAGGCTGGAGTGCAGTGATGG - Intronic
1059950654 9:119459150-119459172 GCTAGGCTGGAGGGCAGTGGTGG + Intergenic
1060203699 9:121668956-121668978 CCCAGGCTGGAGTTCAGTGGTGG + Intronic
1060676020 9:125515601-125515623 ATTAGGCTGGGGCTGAATGATGG - Intronic
1060753060 9:126186873-126186895 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
1060921027 9:127420420-127420442 CCTAGGCTGGAGTGCAGTGGCGG - Intergenic
1061024889 9:128042091-128042113 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1061314992 9:129789669-129789691 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1061435040 9:130555806-130555828 AGCAGGCTGGAGTTCAGTGGTGG + Intergenic
1061457228 9:130707761-130707783 CCCAGGCTGGAGTACAGTGACGG + Intergenic
1061497751 9:130985319-130985341 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1061660202 9:132125008-132125030 ACGTGGCTGGAGCTCAATGGGGG + Intergenic
1203736548 Un_GL000216v2:143857-143879 GCTGGGCTGGAGCACAGGGACGG - Intergenic
1203490668 Un_GL000224v1:102116-102138 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1203503292 Un_KI270741v1:43995-44017 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1185750269 X:2605264-2605286 CCCAGGCTGGAGTGCAGTGACGG - Intergenic
1185836817 X:3352350-3352372 TCCAGGCTGGAGTGCAGTGATGG + Intergenic
1186213112 X:7271062-7271084 ACTGGACTGGAGCCCAGTGCTGG + Intronic
1186542303 X:10413047-10413069 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1186882914 X:13884133-13884155 CCCAGGCTGGAGCGCAGTGGTGG - Intronic
1187342139 X:18430902-18430924 CCCAGGCTGGAGTGCAGTGATGG + Intronic
1187891172 X:23936159-23936181 AGTAGGGTGGAGGGCAGTGAGGG + Intronic
1188136606 X:26500696-26500718 ACATACCTGGAGCTCAGTGAGGG - Intergenic
1188671499 X:32887302-32887324 TCCAGGCTGGAGTGCAGTGATGG - Intronic
1188699395 X:33239229-33239251 CCCAGGCTGGAGTTCAGTGGTGG - Intronic
1189269030 X:39737372-39737394 ACAAGGCTGGAGGTAGGTGAGGG - Intergenic
1189401761 X:40676239-40676261 CCCAGGCTGGAGCGCAGTGGTGG - Intronic
1190049187 X:47136739-47136761 ACCAGGCTGGAGTGCAGTGGTGG - Intergenic
1190102554 X:47532977-47532999 CCTAGGCTGGAGTGCAGTGGTGG - Intergenic
1190197946 X:48335690-48335712 ACCAGGCTGGAGTGCAGTGGCGG - Intergenic
1190343608 X:49317388-49317410 ACCAGGCTGGAGTGCAGTGGTGG + Intronic
1190664693 X:52686125-52686147 ACCAGGCTGGAGTGCAGTGGCGG - Intronic
1190674729 X:52772293-52772315 ACCAGGCTGGAGTGCAGTGGCGG + Intronic
1190710203 X:53062623-53062645 CCCAGGCTGGAGTACAGTGATGG + Intronic
1192447279 X:71220547-71220569 CCCAGGCTGGAGTGCAGTGACGG + Intronic
1192478422 X:71464073-71464095 CCTAGGCTGGAGAACAGGGAAGG - Exonic
1192512846 X:71735627-71735649 CCCAGGCTGGAGTGCAGTGATGG + Intergenic
1192513851 X:71745882-71745904 CCCAGGCTGGAGTGCAGTGATGG - Intergenic
1192942166 X:75924020-75924042 ACTTGGCTAGAAATCAGTGATGG + Intergenic
1193036616 X:76958067-76958089 ACTCTGCTGGAGCTCTCTGAAGG + Intergenic
1193128386 X:77893858-77893880 CCCAGGCTGGAGTTCAGTGGTGG - Intronic
1193128837 X:77898403-77898425 ACCAGGCTGGAGTGCAGTGGTGG + Intergenic
1193213618 X:78837440-78837462 CCTAGGCTGGAGTGCAGTGGTGG + Intergenic
1193679049 X:84495185-84495207 TCAAGGCTGGAGAACAGTGAGGG + Intronic
1194036055 X:88873901-88873923 CCTAGGCTGGAGTGCAGTGGCGG + Intergenic
1194298673 X:92158676-92158698 ACCAGGCTGGAGTTCAGTGGCGG + Intronic
1194530101 X:95036430-95036452 CCTAGGCTGGAGTGCAGTCATGG - Intergenic
1195674417 X:107496987-107497009 TCAAGGATGGAGCTCAGTGTGGG + Intergenic
1196420605 X:115517000-115517022 CCCAGGCTGGAGTCCAGTGATGG + Intergenic
1196684789 X:118501441-118501463 CCTAGGCTGGAGTGCAGTGGTGG - Intronic
1196928963 X:120661940-120661962 CCCAGGCTGGAGTTCAGTGGTGG - Intergenic
1197085724 X:122472441-122472463 ACTAGACTAGAGCCCACTGATGG - Intergenic
1197880949 X:131165808-131165830 GCTAGGCTGGAGCTGACTGTAGG + Intergenic
1197925060 X:131637486-131637508 ACCAGGCTGGAGTGCAGTGGCGG + Intergenic
1197963829 X:132034732-132034754 GCTAGGCTGGAGATAAGGGAAGG + Intergenic
1198110728 X:133500724-133500746 CCTAGGCTGGAGTGCAGTCATGG + Intergenic
1198370959 X:135988639-135988661 CCTAGGCTGGAGTGCAGTGGTGG + Intronic
1198802091 X:140458498-140458520 CCCAGGCTGGAGCACAGTGATGG + Intergenic
1199786670 X:151112305-151112327 ACTCTGCTGGAGCTCTCTGATGG + Intergenic
1200224733 X:154411323-154411345 CCCAGGCTGGAGTGCAGTGATGG - Intronic
1200616285 Y:5383659-5383681 GCCAGGCTGGAGTTCAGTGGTGG + Intronic
1201239753 Y:11947385-11947407 TCCAGGCTGGAGTGCAGTGATGG - Intergenic
1201372085 Y:13276677-13276699 CCCAGGCTGGAGTGCAGTGACGG - Intronic
1201966553 Y:19742780-19742802 ACCAGGCTGGAGTGCAGTGGCGG - Intronic