ID: 970934611

View in Genome Browser
Species Human (GRCh38)
Location 4:21554365-21554387
Sequence TTTGATGGGGAGCCAAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970934611 Original CRISPR TTTGATGGGGAGCCAAGACT GGG Intronic
901600967 1:10423049-10423071 TTTGTGGCGGAGCCAAGATTGGG - Intergenic
902892767 1:19456495-19456517 GTTGAAGGGAACCCAAGACTGGG - Intronic
905106146 1:35564685-35564707 TTTGAGGGTGAGCCAGAACTGGG - Intronic
907267929 1:53274154-53274176 CCTGATGGGGAGACCAGACTTGG - Intronic
909353332 1:74678881-74678903 TTTGATGGGGAGTCTTGGCTTGG - Intergenic
913486498 1:119336416-119336438 TTTGAGCCAGAGCCAAGACTAGG + Intergenic
917516243 1:175710945-175710967 TTTGATGGGGAGCACAGAACAGG - Intronic
917727006 1:177837825-177837847 TTTGGTTGGGAGAAAAGACTGGG - Intergenic
917932558 1:179833229-179833251 TCTGATGGGGAGTAAAAACTGGG - Intergenic
918087699 1:181259520-181259542 TTTTCTGGGGAGCCCAGACTGGG + Intergenic
924800967 1:247329536-247329558 TTTCCTTCGGAGCCAAGACTCGG + Exonic
1064453761 10:15467570-15467592 TTTGATGGGGAGCAAGGGGTAGG + Intergenic
1064455932 10:15487518-15487540 TTTCATGGGGAGGGAAGAATGGG + Intergenic
1064823079 10:19361683-19361705 TTTCATGGAGAGCCAATTCTGGG + Intronic
1067466301 10:46501780-46501802 CTGGATGGGGAGCCAGGACTCGG - Intergenic
1067548552 10:47215663-47215685 TTTGATGCAGAGCAAAAACTAGG + Intergenic
1067620887 10:47882825-47882847 CTGGATGGGGAGCCAGGACTCGG + Intergenic
1068403804 10:56564174-56564196 ATGGATGGGGAGCCAACAGTGGG - Intergenic
1069514629 10:69067838-69067860 TTTGATTGGAAGAGAAGACTTGG + Intergenic
1069612919 10:69787323-69787345 TTTCATGGGCTGCCTAGACTTGG - Intergenic
1069824949 10:71249345-71249367 TTTGAGGGGCAGCCAGGAATTGG - Intronic
1071438465 10:85668419-85668441 TTTGATTTGGAGTCAAGAATAGG - Intronic
1075318730 10:121472391-121472413 TCTCATGGGGAGTCAAGACCAGG + Intergenic
1077204147 11:1333692-1333714 TTTGCTGAGCAGCCAAGGCTGGG - Intergenic
1081650029 11:44817726-44817748 TTTTATGGAGAGGGAAGACTTGG + Intronic
1082853371 11:57785036-57785058 TTTTTGGAGGAGCCAAGACTTGG + Intronic
1086421164 11:86638881-86638903 TTTGATGAGGAGGCAAGTCGGGG - Intronic
1089073041 11:115716149-115716171 TTTGATGGGAAACCAACGCTTGG - Intergenic
1096752362 12:53769155-53769177 TCTGATTGGCAGCCAAGTCTGGG + Intergenic
1098594515 12:72256219-72256241 AATAATGGGGAGCCAAGACTGGG - Intronic
1102659006 12:114508726-114508748 TTTAATGTCCAGCCAAGACTCGG - Intergenic
1109761544 13:66836439-66836461 TTTGATAGGCAGATAAGACTAGG - Intronic
1113028548 13:105968765-105968787 TATGTTAGGGAGCCATGACTAGG - Intergenic
1116762969 14:49037824-49037846 TTTAATGGGAAGCCAAAATTAGG - Intergenic
1121699920 14:95944746-95944768 TTTGCTCGGCAGCCCAGACTCGG + Intergenic
1122112673 14:99513243-99513265 TTTGAGTGGCAGCCAAGTCTGGG - Exonic
1126848245 15:52781678-52781700 TTTGATGTGCAGCCAAGTTTGGG - Intronic
1128281387 15:66397452-66397474 CTTTATGGGGAGGCAAGAGTGGG + Intronic
1130901308 15:88208754-88208776 TTTGATGTGCAGCCAGCACTGGG - Intronic
1131543456 15:93295390-93295412 TTTCCTGGGATGCCAAGACTTGG - Intergenic
1131665296 15:94565231-94565253 TCTGAGGGAGAGCCAAGAATTGG - Intergenic
1131959359 15:97772877-97772899 TTGGAAGGGGAGGGAAGACTGGG - Intergenic
1132232343 15:100193438-100193460 AGTGCTGGGGAGCCAACACTGGG - Intronic
1132643656 16:989113-989135 TGGGTTGGGGAGGCAAGACTGGG - Intergenic
1134937992 16:18262965-18262987 TTCTATGGGGAGCCAGGGCTTGG - Intergenic
1135740805 16:24973667-24973689 TTTTATGGGGGGCCCAGAATGGG - Intronic
1140136035 16:72206354-72206376 TTTGTAGGTGAGCCAAGATTTGG + Intergenic
1140706788 16:77638140-77638162 TCTGATTGAGAGCCAAGATTGGG - Intergenic
1144218651 17:13080152-13080174 TTTCATGGGGAGGCAGGACAGGG + Intergenic
1148937012 17:51171249-51171271 TTTGATGGGGAGGCCAGACTTGG + Intronic
1151788269 17:76287248-76287270 GTTGAGGGAGAGCCAAGACAGGG - Exonic
1153658603 18:7306776-7306798 TTTGATGGGGAGAGAAGAGAAGG - Intergenic
1157116214 18:44864833-44864855 GTTGAGGGGGATCCAAGACAGGG - Intronic
1158494582 18:57942903-57942925 GTTGATGGGGAGGAAAGACATGG + Intergenic
1162582730 19:11540422-11540444 AGAGATGGGGACCCAAGACTGGG + Intronic
1163268041 19:16233343-16233365 TGTGCTGGGGAGCCAAAGCTCGG - Intronic
1163934237 19:20427271-20427293 TTTCATGGGAAGCATAGACTGGG + Intergenic
926061511 2:9807779-9807801 CTTGCTGGGGAGCCCAGTCTGGG - Intergenic
926294348 2:11557883-11557905 TTTTATGGGGAGCCGAGAAATGG + Intronic
928237954 2:29561789-29561811 TTTCATGGGGAGCCAGGGTTGGG - Intronic
928389769 2:30900123-30900145 TTTGAAGGCCAGCCAGGACTCGG + Intergenic
928693472 2:33824614-33824636 TTTGATAGAGAGACAAAACTAGG + Intergenic
929403694 2:41615221-41615243 TTTGAAGTGGATCCAAGAATAGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932306260 2:70705918-70705940 TTTGGTGAGGAGGGAAGACTGGG + Intronic
939451165 2:142376420-142376442 ATTGATGGGGAGCCAAAAGGTGG - Intergenic
940364026 2:152826097-152826119 TGTGATGTAGAGCCAGGACTCGG + Intergenic
941874255 2:170417459-170417481 TTAGATTGGGAGTCCAGACTTGG - Intronic
942688727 2:178562596-178562618 ATTCATTGGAAGCCAAGACTCGG + Exonic
943207132 2:184914436-184914458 TTTGGTGGGAAGCCATAACTGGG - Intronic
944345381 2:198659202-198659224 CTTCATGGGGAGCCAACTCTGGG + Intergenic
945234056 2:207618143-207618165 TTTGATGCCCAGCCAAGGCTGGG - Intronic
948886344 2:240887024-240887046 TCTGTTGGGGAGCCAAGAACAGG + Exonic
1170132194 20:13032630-13032652 AATGAGGGAGAGCCAAGACTGGG - Intronic
1170199318 20:13725414-13725436 TGTGAAGGGGAGCAAAGACGTGG - Intronic
1172597826 20:36162440-36162462 TTTCAAGGAGAGCCAGGACTAGG - Intronic
1173104733 20:40123229-40123251 TTTGATGGGGAGCCTGGAGAAGG - Intergenic
1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG + Exonic
1174112438 20:48205779-48205801 TTTGGTGGGGAGGCCAGTCTTGG + Intergenic
1178824071 21:36000762-36000784 TCTTATTGGGAGCCAATACTGGG + Intronic
1179245053 21:39625796-39625818 CTTGAAGGGAAGCCAAGACTAGG - Intronic
1179952406 21:44716330-44716352 AATGATGGGGAGCCCAGCCTTGG - Intergenic
1183984822 22:41563587-41563609 ATTCCTGGGGAGCCAGGACTGGG - Intronic
1184693327 22:46127274-46127296 TGTGCTGGGGAGCCAGGACAGGG - Intergenic
1184927586 22:47654114-47654136 TGTGAAGGGGAGACAAGGCTGGG + Intergenic
954622601 3:52004588-52004610 TTTGATGGGGAGAAAAAGCTGGG - Intergenic
956132990 3:66071741-66071763 ATTGATGAGAACCCAAGACTAGG + Intergenic
959529400 3:107415554-107415576 TTTTCTGGGGAGCCAAAATTGGG + Intergenic
959863251 3:111239163-111239185 TATGATGGTGAGCCAAGAACAGG - Intronic
963924569 3:150938014-150938036 CTGGATGGGCACCCAAGACTTGG - Intronic
966098649 3:176239101-176239123 TTTGGTGTGGAGAAAAGACTGGG - Intergenic
967974528 3:195025641-195025663 TTTTATGGGGAGCTAAGAAGAGG - Intergenic
970083515 4:12318155-12318177 TTTATTGGTGAGCCAAGATTGGG - Intergenic
970934611 4:21554365-21554387 TTTGATGGGGAGCCAAGACTGGG + Intronic
972914927 4:43864952-43864974 TTTGATGGTGAGAGAAGAGTGGG - Intergenic
975862337 4:78690773-78690795 TATAAAGGGGAGCCAAGAATTGG - Intergenic
978407352 4:108394646-108394668 TTTGAAGGGGATGCAAGACCGGG - Intergenic
980288550 4:130813590-130813612 TGTGATGGAGAGTCAAGAATAGG - Intergenic
984375337 4:178922354-178922376 GTCCATGGGCAGCCAAGACTGGG - Intergenic
986261586 5:6152195-6152217 GTTGATGGGAAGAGAAGACTAGG - Intergenic
987295951 5:16551532-16551554 TTTGGGAGGGAGCCAAGAATGGG - Intronic
987960873 5:24806553-24806575 TTTGATTGGGAGTTAACACTTGG - Intergenic
992468611 5:77031357-77031379 TTTAATGGGGAACTGAGACTCGG - Intronic
992839278 5:80671345-80671367 TTGGATGGGAAGTAAAGACTTGG + Intronic
997881539 5:137596152-137596174 TTGGATTGGGAGCAGAGACTTGG - Intronic
1000776063 5:165422007-165422029 TTTAATGGGTAGCCAAGAAAGGG + Intergenic
1001191201 5:169633157-169633179 TCTGATGGGAGGCCAAGAGTAGG - Intergenic
1002600315 5:180350803-180350825 TCTCATGGGAAGCCAGGACTCGG - Intronic
1007121550 6:39386392-39386414 TTAGATGTGAAGACAAGACTTGG + Intronic
1007224021 6:40300308-40300330 TTTGGTGGGGAACCCAGACTAGG - Intergenic
1007566757 6:42857431-42857453 TTTGAAGGGAAGTCAAGAGTAGG + Intronic
1007704036 6:43780448-43780470 TTTGGTGGGAAGCCGAGACTGGG - Intronic
1007899285 6:45394957-45394979 TGTGGGGGGGAGGCAAGACTAGG + Intronic
1010116297 6:72316524-72316546 CTTGATAGGGAGCCAAGGCCAGG - Intronic
1010159850 6:72840562-72840584 TTTGAAGGGGAGTCAATACTTGG - Intronic
1010927778 6:81764471-81764493 CTTGTTGCGGAGCCATGACTGGG - Intergenic
1012657548 6:101843834-101843856 TTTAATGTGTAGCCAAGGCTGGG + Intronic
1013558953 6:111285343-111285365 TTTCATGGGAAGCATAGACTGGG + Intergenic
1014908905 6:127065173-127065195 TTTGATGGTGATTCAAAACTAGG - Intergenic
1014943597 6:127471875-127471897 TTTGACGGGGAGGAGAGACTTGG - Intronic
1019186958 6:170226254-170226276 GTTGTTGGGGTGCCAAGACGGGG - Intergenic
1020399136 7:7755089-7755111 TTCGATGTGGAGTGAAGACTTGG - Intronic
1022977143 7:35569198-35569220 TCTGATGGGTAGACATGACTGGG + Intergenic
1024245602 7:47467592-47467614 GTTGCTGGGGACCCAAGTCTGGG - Intronic
1025204440 7:56983860-56983882 GTTTGTGGTGAGCCAAGACTGGG + Intergenic
1025667497 7:63593074-63593096 GTTTGTGGTGAGCCAAGACTGGG - Intergenic
1027886922 7:83920347-83920369 TTTGATGGAGAGCCATAACACGG - Intergenic
1029526122 7:101095047-101095069 TTTGACGCGGAGCCCAGCCTTGG - Intergenic
1033668926 7:143471270-143471292 TTTCATGGGGAGACAAAAGTTGG - Intergenic
1040583260 8:48715299-48715321 TTTGTTGGGGAGACAAGAGCTGG - Intronic
1041250600 8:55930729-55930751 GTTGATGGGGGACCAAGACCTGG + Intronic
1043597569 8:81902718-81902740 TTGCATGGGGAGCAGAGACTAGG + Intergenic
1044776286 8:95692450-95692472 TTTGAGGAGGAGCCACGTCTTGG - Intergenic
1046313001 8:112463619-112463641 TTTGATGAGGACCCAACCCTTGG - Intronic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1048833571 8:138497881-138497903 TTAGAGAAGGAGCCAAGACTGGG + Intergenic
1052829538 9:33203527-33203549 TTTGATGGGGCCCCAGGAGTGGG - Intergenic
1055290614 9:74778702-74778724 TTTGAGTGGGAGCCAAGTCTGGG - Intronic
1055644294 9:78348234-78348256 TTCGATGGGGAGCCATGGCCAGG - Intergenic
1056264442 9:84882424-84882446 TTTGATGGAGAGCCACCCCTTGG + Intronic
1056590586 9:87963402-87963424 TTGAATGGTGAACCAAGACTGGG + Intergenic
1057480878 9:95444776-95444798 TTGGATGGGGAGCCGACACTGGG + Exonic
1058040729 9:100298715-100298737 TTTGATGGGGGGCAAAAACCTGG + Intronic
1058144044 9:101390907-101390929 TTTGATTGGTAGGCAAGATTTGG - Intronic
1059658544 9:116378635-116378657 TTTGATGGAATGCCAAAACTGGG + Intronic
1060918193 9:127403537-127403559 TGGGATGAGGAGCCAAGACGTGG + Intronic
1061065992 9:128277702-128277724 TGAGATGGGGAGCCCAGGCTTGG + Intronic
1186857549 X:13640469-13640491 TGTGAGGGAGAGCCAAGACTGGG - Intergenic
1190297135 X:49034294-49034316 TCTGAGGAGGAGCCAAGCCTGGG - Intronic
1193180848 X:78454726-78454748 TTTCATAGAGAGCCAAAACTGGG - Intergenic
1198138388 X:133777813-133777835 TCTGATGCAGAGCCAAGTCTGGG + Intronic
1200045482 X:153398606-153398628 TTTGATGGGGAATCAAGCTTCGG + Intergenic
1201613967 Y:15875007-15875029 TCTAATGTGGAGCCAAGAATAGG + Intergenic
1201616402 Y:15904773-15904795 TCTAATGTGGAGCCAAGAATAGG - Intergenic