ID: 970934892

View in Genome Browser
Species Human (GRCh38)
Location 4:21557824-21557846
Sequence TTTCTATAGTTACAAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970934892_970934893 -8 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934893 4:21557839-21557861 TATAGAAAAACAACTTACGAAGG 0: 1
1: 0
2: 1
3: 41
4: 558
970934892_970934894 1 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934894 4:21557848-21557870 ACAACTTACGAAGGAAGATGTGG 0: 1
1: 0
2: 0
3: 9
4: 127
970934892_970934898 27 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934898 4:21557874-21557896 TTCTTCTACCACAGGTAGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 110
970934892_970934897 19 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934897 4:21557866-21557888 TGTGGGGATTCTTCTACCACAGG 0: 1
1: 0
2: 0
3: 7
4: 118
970934892_970934895 2 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934895 4:21557849-21557871 CAACTTACGAAGGAAGATGTGGG 0: 1
1: 0
2: 0
3: 7
4: 96
970934892_970934896 3 Left 970934892 4:21557824-21557846 CCTGGGCTTTGTAACTATAGAAA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 970934896 4:21557850-21557872 AACTTACGAAGGAAGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970934892 Original CRISPR TTTCTATAGTTACAAAGCCC AGG (reversed) Intronic
901864773 1:12097548-12097570 TTTCCAAAGTTACAAAACTCTGG + Intronic
902910307 1:19591280-19591302 TTTGTTTGGTTCCAAAGCCCAGG - Intergenic
903790275 1:25888050-25888072 TTTCTGGAGTCAGAAAGCCCTGG + Intronic
905822361 1:41003516-41003538 TTTCAATAGCTCCAGAGCCCAGG - Intronic
906987508 1:50700358-50700380 TTACTAGAATTACAAAGGCCGGG - Intronic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
908909813 1:69060207-69060229 CTTCTCTAGTTACATAGCCTGGG + Intergenic
910428668 1:87139882-87139904 TTCCTGTAGTCACAAAGCACAGG - Intronic
919027513 1:192196077-192196099 CTCCCATAGTTACACAGCCCTGG + Intergenic
920941419 1:210486707-210486729 TTTGTATACTTACAAAGTCAGGG + Intronic
921287310 1:213620884-213620906 TTTCTATAGTTTTAAACCACAGG + Intergenic
922827484 1:228531856-228531878 TTTCTATTGTTAGAATGCCTGGG + Intergenic
922827813 1:228533771-228533793 TTTCTATCATTACAATGCCTGGG + Intergenic
922827828 1:228533841-228533863 TCTCTATAATTAGAATGCCCGGG + Intergenic
922829291 1:228543322-228543344 TTTCTATCCTTACAATGCCTAGG + Intergenic
922829411 1:228543986-228544008 TTTCTATAATTACAATGCCTGGG + Intergenic
922829512 1:228544600-228544622 TTTCTGTAATTACAATGCCTGGG + Intergenic
923903329 1:238354369-238354391 ATTCTATAGCTAGAAAACCCTGG - Intergenic
924080524 1:240392801-240392823 TTTCCATAGTTCTAAATCCCAGG - Intronic
1062865720 10:851670-851692 TTTATATAGTTACAAAGATTTGG - Intronic
1062959876 10:1564821-1564843 TTGCTATTATTACAAAGCTCTGG - Intronic
1067745838 10:48935020-48935042 ATGCTTTATTTACAAAGCCCAGG - Intronic
1072434987 10:95406674-95406696 TTACTATAGTGACTAAGGCCAGG - Intronic
1073384374 10:103111168-103111190 TTTCTGTGGTTCCAAAACCCAGG + Intronic
1078053179 11:7985032-7985054 TTTCTCTAGCAACATAGCCCAGG - Intronic
1078119100 11:8488190-8488212 TTTCAACAATTACAAATCCCTGG - Intronic
1078730862 11:13972862-13972884 TTCCCATATTTGCAAAGCCCAGG + Intronic
1083973422 11:66097585-66097607 ATTCTATAGGTCAAAAGCCCAGG - Intronic
1088695322 11:112361399-112361421 TTTCTATAGGTCATAAGCCCTGG - Intergenic
1091037576 11:132247274-132247296 TTTGTATAATTCCAATGCCCAGG - Intronic
1091487079 12:899956-899978 TTTCTAAAGCTAAAAAGCTCTGG + Intronic
1092089379 12:5791615-5791637 TTTCTAGAGTTAGACAGGCCTGG + Intronic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097196425 12:57244559-57244581 TCTCTATCGGTTCAAAGCCCTGG - Exonic
1098977414 12:76917680-76917702 TTTCTTTTTTTACAAAGACCAGG + Intergenic
1099123712 12:78725568-78725590 TATATATAGGTACAAAGCACTGG - Intergenic
1100172853 12:91996366-91996388 TATCTACAGTAACAAAACCCAGG - Intronic
1101557452 12:105823602-105823624 TTTCTCTAGTTCCAAAGCTTGGG - Intergenic
1102890234 12:116552970-116552992 TTTCTATATTTAAGAAACCCAGG + Intergenic
1105658151 13:22463038-22463060 TATCTAAAGTTACAAAGACAGGG + Intergenic
1105910167 13:24857003-24857025 TATCTATATTTCCAAAGCCATGG - Intronic
1106246826 13:27957464-27957486 TTTCTTTAGTTACAAATCAGAGG - Intergenic
1108079712 13:46722392-46722414 TTTTTAATGATACAAAGCCCAGG - Intronic
1109734368 13:66462619-66462641 TTTTTAATGTTTCAAAGCCCAGG - Intronic
1110809320 13:79793997-79794019 TTTCTAGGGTTATAAAGCCATGG + Intergenic
1112424290 13:99282805-99282827 TTGCTATAGTTACCAAGACATGG - Intronic
1114829801 14:26127186-26127208 TTTCTAATGTTACAAAGCTGAGG - Intergenic
1115952001 14:38732036-38732058 TTTCCATAGTAACAGAGCCCAGG + Intergenic
1118113324 14:62747486-62747508 TTTCTATAGCCACAAAGGCATGG + Intronic
1118784178 14:69032120-69032142 TTTCTATAGTTTCAAATCATTGG - Intergenic
1120455410 14:84723893-84723915 ATTCTATACTTAGAAGGCCCAGG + Intergenic
1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG + Intergenic
1130850409 15:87787741-87787763 TATCAATACTTACAAAGCCATGG - Intergenic
1136749606 16:32622175-32622197 TTTCTATACTTACTAGTCCCAGG - Intergenic
1137050758 16:35711641-35711663 TTTCTATAGTTAGACTGCCCGGG + Intergenic
1139290168 16:65850698-65850720 TTTCTATAGGCCCAAGGCCCTGG - Intergenic
1140207122 16:72942474-72942496 ATTCTCTATTTAGAAAGCCCTGG - Intronic
1141237089 16:82228766-82228788 ATTTTATAATTCCAAAGCCCGGG - Intergenic
1203051739 16_KI270728v1_random:881385-881407 TTTCTATACTTACTAGTCCCAGG - Intergenic
1143298057 17:5885988-5886010 TTGTTCTAGTTACAAAGCCCAGG + Intronic
1143811460 17:9475044-9475066 TTTCTATAGATACTATGACCTGG + Intronic
1148067585 17:44883860-44883882 TGTCTATACTTACATAGCTCTGG + Intronic
1149794230 17:59504913-59504935 TTACTATAATTACAACGCTCTGG + Intergenic
1149985868 17:61346618-61346640 ATTTAATAGTTACATAGCCCTGG - Intronic
1153027241 18:682945-682967 TTTCTGTATTTACAAAGCATAGG + Intronic
1153589949 18:6663105-6663127 TTTTTATTATTCCAAAGCCCAGG + Intergenic
1154156259 18:11946779-11946801 TTTCCAAAATTACATAGCCCAGG + Intergenic
1154282604 18:13018606-13018628 TTTCTATACTTACTAGTCCCAGG - Exonic
1156199674 18:34816072-34816094 GTTCTACAGTTAGTAAGCCCAGG + Intronic
1156268223 18:35507715-35507737 TTTCTATAGTTAAAGCTCCCAGG + Intergenic
1156289410 18:35732926-35732948 ATTCCATTGTTACTAAGCCCAGG + Intergenic
1156678282 18:39557759-39557781 TTTTTATAGATATATAGCCCAGG - Intergenic
1156734975 18:40245282-40245304 TTTCTTGAGTCACAAAGGCCAGG + Intergenic
1157470665 18:47985557-47985579 TTGCTATGGTGACACAGCCCTGG - Intergenic
1160239845 18:77115196-77115218 TTCCTCTAGTTACTAAGACCAGG - Intronic
1164374097 19:27670685-27670707 TTTCTAAAGATACAAACCCATGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
927045722 2:19276204-19276226 TTCCCATGGTTACAAACCCCTGG + Intergenic
928233333 2:29519132-29519154 TTTCCAAAGTTACAAAGCCAAGG + Intronic
930069548 2:47354810-47354832 TTCCTATAGTTACAAGGGCTTGG + Intronic
930135883 2:47904838-47904860 TGTCTTTAGTTACGAACCCCTGG - Intronic
933783719 2:85820962-85820984 TTTCTTTAGTTCCAAATTCCTGG - Intergenic
936810103 2:116388206-116388228 TTTCCATTGTTATAAACCCCAGG + Intergenic
942825936 2:180176493-180176515 TTTCAATAGTTACAAATCAAAGG - Intergenic
942923804 2:181409452-181409474 TTTGAATACTTACAAAACCCAGG - Intergenic
943329460 2:186541894-186541916 TTTCTATAGGGACAAACCCAAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945920417 2:215749686-215749708 TCTCCATAGTGACACAGCCCTGG + Intergenic
947651898 2:231793769-231793791 TTTCCATAGCTACAAATCCAAGG - Intronic
1168838432 20:893324-893346 TGTCTATAATTCCAAAGTCCCGG - Intronic
1169718834 20:8649764-8649786 TTCCTACAGTTACAAAGGCTGGG - Intronic
1173131163 20:40395038-40395060 TGTCTACAGAGACAAAGCCCAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1181878709 22:25960304-25960326 TTTCAGTAGTTACAGGGCCCGGG + Intronic
1181878889 22:25961621-25961643 TTTCAGTAGTTACAGGGCCCGGG + Intronic
949444010 3:4114308-4114330 CATCTACAGTTACAAACCCCTGG + Intronic
959461225 3:106628344-106628366 TTTCTGTAGGTCCAAAGTCCAGG - Intergenic
960945512 3:122963803-122963825 TCTCTGTTGTTACAAAGTCCAGG + Intronic
962908042 3:139823184-139823206 TTTCTAAAGTTACAATACTCAGG - Intergenic
962964593 3:140341769-140341791 TTACTACAGTTACAATGTCCTGG + Intronic
963045230 3:141097330-141097352 TTTCTGTAGTTTGAAAGCCTTGG - Intronic
965123119 3:164589313-164589335 TTTCTACAGTAACAAAGACATGG - Intergenic
969069463 4:4523445-4523467 TTTCTATATTTACAACTGCCTGG + Intronic
969889225 4:10244180-10244202 TTTCTATAGTTATTGAGCACTGG + Intergenic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
971181740 4:24334892-24334914 TTTCTATATTTAGAAACCCAAGG + Intergenic
972650457 4:41012701-41012723 TATCTATATTAACACAGCCCTGG + Intronic
975738402 4:77404455-77404477 TATCTATGGTGACAAAGCACTGG + Intronic
978114056 4:104998150-104998172 AGTCTATATTTACAAAACCCTGG - Intergenic
978351132 4:107822131-107822153 TTTTCAAATTTACAAAGCCCAGG - Intergenic
978584322 4:110261380-110261402 AATCTATAGTTCCACAGCCCTGG + Intergenic
979339510 4:119504551-119504573 TTTCTGCAATTACAAAACCCTGG - Exonic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983658544 4:170108447-170108469 ATTATATAGTTAGAAAGCTCAGG + Intergenic
984691037 4:182726337-182726359 TTTCTATAACTGAAAAGCCCAGG + Intronic
986606249 5:9526173-9526195 TTTCAATATTTATAAATCCCTGG - Intronic
987639222 5:20590087-20590109 TTTCTATAGAAAGAAAGCCTTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
992858894 5:80891949-80891971 TTTCTATGGTGACAATGCTCTGG + Intergenic
994008456 5:94870574-94870596 TTTCTAAAGTTTCAAAGTCCTGG + Intronic
995229234 5:109739891-109739913 TCTCTAAAGATTCAAAGCCCTGG - Intronic
996219830 5:120917229-120917251 TTTCTATAGTGGCTAACCCCAGG - Intergenic
996961764 5:129259042-129259064 TTTATATTGTTCCCAAGCCCAGG - Intergenic
998735874 5:145140130-145140152 TTTCAAAAGTTACAAATACCTGG - Intergenic
999055872 5:148575631-148575653 TTTCTATAATTGCAAAACACTGG + Intronic
999173747 5:149617227-149617249 TTTATATAATTCCAAACCCCTGG - Intronic
999719317 5:154386896-154386918 GTTGTAAAGTTACAAAGGCCTGG + Intronic
1001991600 5:176120971-176120993 TTTCTATACTTACTAGTCCCAGG - Intronic
1002225273 5:177717150-177717172 TTTCTATACTTACTAGTCCCAGG + Intronic
1002268572 5:178053964-178053986 TTTCTATACTTACTAGTCCCAGG - Intronic
1003098371 6:3158859-3158881 TTTGTATAAATAAAAAGCCCAGG + Intergenic
1003352606 6:5332149-5332171 TCTCTAAAGTTACACAGTCCTGG - Intronic
1009393091 6:63166064-63166086 TTTTTATATTTATAAATCCCTGG + Intergenic
1010600395 6:77818517-77818539 TGTGTATATTTACAAAGACCAGG - Intronic
1010915720 6:81616004-81616026 TTTCTTTATGTACAAAGCACTGG - Intronic
1011557903 6:88588404-88588426 TTTCTGTTCTTGCAAAGCCCAGG + Intergenic
1012459173 6:99441759-99441781 TTTCTAGAAGTACAAAGTCCAGG - Intronic
1013852916 6:114537633-114537655 GTTCTATAGTTGCAAGGACCTGG - Intergenic
1014977223 6:127902400-127902422 TTTCTTTAGTAACCAAACCCAGG + Intronic
1015024412 6:128516866-128516888 TTTCTGTAGTTAGAAATGCCAGG + Intronic
1015630292 6:135225538-135225560 TGTATATAGTTACAAAGCCCAGG + Intergenic
1016301248 6:142634170-142634192 TTTCTATAGTTTTAGAGCCTAGG - Intergenic
1017948641 6:159117135-159117157 TTTCCAGAGGTACAGAGCCCTGG - Intergenic
1020715720 7:11673369-11673391 TTGCTATAGTTGCACAGCACAGG - Intronic
1020718679 7:11713104-11713126 GATCTATAGTTCCAAAGCCATGG + Intronic
1027688228 7:81305407-81305429 TTTGTATATTTAGAAAGCCATGG - Intergenic
1028514693 7:91664130-91664152 TTTTTATATTCACAGAGCCCAGG + Intergenic
1030788418 7:113692574-113692596 TTCCTAAAGTTACATTGCCCAGG + Intergenic
1032287270 7:130549254-130549276 TTTTTATATTTACAATGCCTAGG + Intronic
1032979036 7:137260600-137260622 TTTTTACTTTTACAAAGCCCAGG + Intronic
1033377570 7:140777642-140777664 TTTCTAAAATTCCAGAGCCCAGG + Intronic
1033898600 7:146107427-146107449 TTTCTTTATTTAGAAGGCCCTGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037653385 8:20861620-20861642 TTTTTATATTTACAGAGCTCTGG + Intergenic
1038955975 8:32469219-32469241 TTTCTATAATGACAAAGACATGG + Intronic
1040534989 8:48301392-48301414 TTTCCATAGCTACAAAGGCTAGG - Intergenic
1041805078 8:61840996-61841018 TTTCTCAAGGTACACAGCCCAGG - Intergenic
1043590389 8:81825478-81825500 TTTTTAAAATTACAATGCCCAGG - Intronic
1045801436 8:106105811-106105833 TCTCTACACTTACAAATCCCCGG + Intergenic
1048517625 8:135124974-135124996 TCTCTATAGTTTCAAAGCAGAGG + Intergenic
1050000445 9:1071914-1071936 CTTCTTTAGTAACAGAGCCCTGG + Intergenic
1051302366 9:15665375-15665397 TTTCTATAGTAAGAAATCTCAGG + Intronic
1051819840 9:21151559-21151581 TTTCTATAGTAACAAACTCAGGG - Intergenic
1052133924 9:24887855-24887877 TTTATTTAGTTACAATGGCCTGG - Intergenic
1055569720 9:77604276-77604298 TTTCTCTAAATACAAAGCACAGG - Intronic
1056466450 9:86860373-86860395 TTTATTCAGTTCCAAAGCCCTGG - Intergenic
1058486782 9:105449141-105449163 TTTCTATTATTAGAAAGCACGGG + Intronic
1059425260 9:114217004-114217026 TTTCCAAAGTCACACAGCCCTGG - Intronic
1059841999 9:118227796-118227818 TTTCTATAGGTCCAAAGGCCAGG - Intergenic
1060402624 9:123357277-123357299 TTACTATAGTTACAGGGGCCGGG + Intronic
1060978995 9:127781829-127781851 TTTCTTTACTCTCAAAGCCCAGG - Intergenic
1186408312 X:9323260-9323282 TTTCTATAGTTGTTAAGACCAGG - Intergenic
1188280930 X:28268612-28268634 CTTCCATATTTACAAAGCCCTGG + Intergenic
1191235035 X:58127365-58127387 TCTCTATAATTAGAAAGCCTGGG - Intergenic
1191235720 X:58132213-58132235 TTTCTATTGTTAGAATGCCCAGG - Intergenic
1191241128 X:58190864-58190886 TTTCTATAATTAGAATGCCGGGG - Intergenic
1191241811 X:58195850-58195872 TTTCTATCGTTAGAATGCCTGGG - Intergenic
1191242840 X:58202884-58202906 TCTCTATCATTACAAAGCCTGGG - Intergenic
1194313292 X:92340803-92340825 TTTGTATAGCTAAAAAGCCAAGG - Intronic
1195038775 X:100994458-100994480 ATTCTCTAGTCAGAAAGCCCAGG - Intergenic
1197177825 X:123503715-123503737 TTTTAATAATTACAAACCCCTGG - Intergenic
1199839952 X:151635542-151635564 TTCCAATAGTCACAAAGGCCTGG + Intronic
1200621556 Y:5454917-5454939 TTTGTATAGCTAAAAAGCCAAGG - Intronic
1200687651 Y:6271516-6271538 TTTCTTTAGTGACATAGGCCAGG - Intergenic
1201047620 Y:9903187-9903209 TTTCTTTAGTGACATAGGCCAGG + Intergenic