ID: 970939033

View in Genome Browser
Species Human (GRCh38)
Location 4:21609564-21609586
Sequence TGCTAGGACTAGATTTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970939029_970939033 -3 Left 970939029 4:21609544-21609566 CCTCTGAAGATAGAAAAATTTGC 0: 1
1: 1
2: 9
3: 345
4: 5200
Right 970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970939033 Original CRISPR TGCTAGGACTAGATTTGAAG GGG Intronic
903285893 1:22276434-22276456 TCCTAGGACTTCATTTGTAGAGG - Intergenic
903492243 1:23738234-23738256 TGCCATTACTATATTTGAAGAGG + Intergenic
908556475 1:65261705-65261727 TGCTAGGAGTAGAAAAGAAGTGG - Intronic
908863488 1:68518322-68518344 TATCAGGAATAGATTTGAAGTGG - Intergenic
910659831 1:89660045-89660067 TGCTTGGATAATATTTGAAGGGG - Intronic
916080093 1:161226879-161226901 TGCTGGGAATACATCTGAAGGGG - Exonic
919680382 1:200428698-200428720 GACTAGGACTAGATTTAAGGGGG - Intergenic
920195240 1:204222361-204222383 TGTGAGGACTAGAGGTGAAGAGG - Exonic
920249887 1:204616525-204616547 TCTTAGGACTACATGTGAAGAGG - Intergenic
923409643 1:233694339-233694361 TTCTAGGACTAGACTTGGAATGG + Intergenic
923535628 1:234849163-234849185 TGCTGGGACTAGCTGTGATGTGG + Intergenic
1066748552 10:38628484-38628506 TGCTAGAACTTGAATAGAAGTGG - Intergenic
1066968125 10:42289291-42289313 TGCTAGAACTTGAATAGAAGTGG + Intergenic
1068557775 10:58478063-58478085 TGATAGGACTAGTCTTGCAGTGG - Intergenic
1068610116 10:59050140-59050162 TTCTAGTACTAGAATAGAAGTGG + Intergenic
1073700699 10:105924162-105924184 TACTAGGACAAGCTGTGAAGTGG - Intergenic
1077999280 11:7480392-7480414 TGCTGACACTAGACTTGAAGGGG + Intergenic
1078567299 11:12427400-12427422 TGCTAGGAAGGGATTTGAACAGG - Intronic
1088318767 11:108533620-108533642 TGCAAAGAATAGATTTGAGGGGG - Intronic
1089091774 11:115883999-115884021 AGCTGGGACCAGATTGGAAGAGG - Intergenic
1091639045 12:2220451-2220473 TGCTGACACTAGATGTGAAGGGG + Intronic
1094457611 12:30655459-30655481 TGCTAAGAGTAGATTTTAAGTGG - Intronic
1094562367 12:31567565-31567587 AACTGGGACGAGATTTGAAGTGG - Intronic
1095889953 12:47226682-47226704 TGCAAGGACTAGGTATGAAAAGG - Intronic
1097202927 12:57294979-57295001 AGCTAGGATAAGAGTTGAAGTGG + Intronic
1098199830 12:68042846-68042868 TGCTACTACTAGATTTTAATTGG + Intergenic
1101292521 12:103386277-103386299 TGCTAGTACCAGCTTTGAGGTGG - Intronic
1101662343 12:106776824-106776846 TGCTCTGACTAGATGTGAACTGG + Intronic
1104338880 12:127928568-127928590 GGTTAGGAATAGATTTGGAGGGG + Intergenic
1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG + Intronic
1109742688 13:66575409-66575431 TGATGGGACTAGATGTGAGGAGG - Intronic
1110217442 13:73038415-73038437 TACTATAATTAGATTTGAAGGGG - Intergenic
1110410777 13:75201909-75201931 TCCTAGGTATAAATTTGAAGAGG + Intergenic
1112244911 13:97724003-97724025 TGATATGACTACATTTAAAGGGG - Intergenic
1113429770 13:110240083-110240105 TCCTAGGCCTAGACTTCAAGAGG + Intronic
1115570499 14:34661933-34661955 TCCTAACACTAGATGTGAAGTGG - Intergenic
1121606399 14:95243509-95243531 TGCTAGGACTGGATTTGAAAAGG - Intronic
1124139895 15:27067879-27067901 TGCTAGGATCAGATCAGAAGAGG + Intronic
1124802925 15:32852207-32852229 TGATAAGACTAGATTTGAGATGG - Intronic
1125215568 15:37269591-37269613 TTCTAGAGCTAGATTTGATGTGG - Intergenic
1133513681 16:6485086-6485108 TGCTATGACTAAGTTTGAAGAGG + Intronic
1136487004 16:30579822-30579844 TGCTAGCCCTACTTTTGAAGAGG - Intronic
1136734205 16:32448819-32448841 TGCTAGAACTTGAATAGAAGTGG + Intergenic
1139171009 16:64628888-64628910 CTCTGGGACTAGATATGAAGGGG - Intergenic
1203018873 16_KI270728v1_random:380779-380801 TGCTAGAACTTGAATAGAAGTGG - Intergenic
1203037208 16_KI270728v1_random:653937-653959 TGCTAGAACTTGAATAGAAGTGG - Intergenic
1146278720 17:31531438-31531460 TGCCAGGACCAGAGTCGAAGTGG - Intronic
1150058340 17:62040541-62040563 TGCTAGAAATAGGTTTGATGTGG - Intronic
1152013155 17:77733145-77733167 ATTTAGGACTAGATTTGATGTGG - Intergenic
1152169183 17:78732530-78732552 TGCTGTGACAAGTTTTGAAGAGG - Intronic
1163502539 19:17685602-17685624 TGCTGGGACTATATCTGTAGCGG + Intronic
926311345 2:11678235-11678257 TGCTAGGATGAGATCTGAAAAGG - Intronic
927225860 2:20765903-20765925 TGCTTGGCCTAAATTTAAAGGGG + Intronic
934311528 2:91870627-91870649 TGCTAGAACTTGAATAGAAGTGG - Intergenic
935628060 2:105187297-105187319 TGCTAGGACTGGATTTTACAAGG + Intergenic
936050200 2:109216729-109216751 TGCTAGGACCTGATTTAAATTGG + Intronic
937762080 2:125616702-125616724 AGCTGGGGCTACATTTGAAGTGG - Intergenic
938931577 2:136090794-136090816 TTCTGGGCCTAGATTTCAAGAGG + Intergenic
938950581 2:136250803-136250825 TGCTATGAGTTGATTAGAAGAGG - Intergenic
942917476 2:181328783-181328805 TGATAGGAATAGAATTGAATCGG - Intergenic
1174770515 20:53295264-53295286 TGCAAGGCCAAGATTTGAACAGG - Intronic
1175626532 20:60492796-60492818 TGCAAGAACTAGATTTTAAATGG + Intergenic
1178050875 21:28745811-28745833 TGCTGGGATAGGATTTGAAGGGG - Intergenic
1180538277 22:16416423-16416445 TGCTAGAACTTGAATAGAAGTGG - Intergenic
951896445 3:27614165-27614187 TGCAAACACTAGATATGAAGAGG - Intergenic
956423054 3:69104524-69104546 TGGAAGGAATAGGTTTGAAGAGG + Exonic
956997976 3:74849950-74849972 TGCTATTACTGGCTTTGAAGAGG - Intergenic
957415558 3:79898494-79898516 TGGTTGGAGAAGATTTGAAGGGG - Intergenic
963896088 3:150686565-150686587 TTCTAGGACTAGAAAGGAAGGGG - Intronic
964074307 3:152674623-152674645 TTCTAGGACTGGTTTAGAAGAGG + Intergenic
966124002 3:176554137-176554159 TGCTAGCACTAGATGCTAAGGGG - Intergenic
966519385 3:180856079-180856101 TGGTGGGACTAGAATTGCAGAGG - Intronic
967254508 3:187576085-187576107 TACTGGGACTAGATTAGAGGGGG - Intergenic
970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG + Intronic
971952195 4:33366700-33366722 TGCAAGGATAAGATTTGAAATGG + Intergenic
973584424 4:52376464-52376486 TGCTAGAACAAGATTTACAGAGG + Intergenic
975127667 4:70800324-70800346 TGCCAGGAAGACATTTGAAGTGG + Intronic
979888000 4:126055918-126055940 TGATAAGACTATTTTTGAAGAGG + Intergenic
980069762 4:128231056-128231078 TGGTAGGACTGGATATGAAGGGG + Intergenic
981773175 4:148333844-148333866 TTCTAGGACTAGCCTTGAAATGG - Intronic
983484026 4:168312361-168312383 AGTCTGGACTAGATTTGAAGAGG + Intronic
987206527 5:15633111-15633133 GCATAGGACTATATTTGAAGAGG + Intronic
988472442 5:31552365-31552387 TGCTAGGGCTAGAAATGATGAGG - Intronic
989149021 5:38279850-38279872 TGCTAAGAGTAGATGTTAAGTGG + Intronic
989208091 5:38831430-38831452 TGCTAAAACTAGATTTTACGAGG - Intergenic
989505990 5:42228547-42228569 AGCTAGCACTAGAGTTGCAGAGG - Intergenic
990157570 5:52896468-52896490 TTGTAGGACTAGATTAGACGCGG - Intronic
993772685 5:91950056-91950078 GGCTAGGAAGAGATTTGAAATGG - Intergenic
994153047 5:96472253-96472275 TGCTATGACTAGATTTAATCTGG + Intergenic
995376632 5:111481443-111481465 TGTTTGGGCTAGATTTGTAGTGG - Intronic
996779811 5:127172816-127172838 AGCTAGGACAAGAGCTGAAGAGG + Intergenic
997151048 5:131495579-131495601 TGCTATGACTCGATTTCTAGAGG - Exonic
997203735 5:132028643-132028665 TGCTATAATTACATTTGAAGAGG + Intergenic
998957265 5:147451446-147451468 TCCCAGGACCAGATTTGCAGTGG - Intronic
999073400 5:148771784-148771806 GGCTAGGAAAAGATTTGAAGTGG + Intergenic
1000658390 5:163909677-163909699 TGCTAAGCCTAGATATTAAGAGG - Intergenic
1006722961 6:36171722-36171744 TGCTAGGACTTGGGTAGAAGGGG + Intergenic
1008490367 6:52080077-52080099 TGCAAGGAGGAAATTTGAAGTGG - Intronic
1013170360 6:107632742-107632764 TGCCAAGAGTAGATTTGAAGGGG + Intronic
1015636660 6:135281930-135281952 TGCTTGATGTAGATTTGAAGGGG + Intergenic
1015675779 6:135746694-135746716 TGGTAGTACTAGATATAAAGAGG - Intergenic
1020450803 7:8318649-8318671 TGTAAGTAGTAGATTTGAAGAGG - Intergenic
1021808210 7:24377512-24377534 TTCTAGGACCAGCTTTCAAGGGG - Intergenic
1028807458 7:95044992-95045014 TTCTAGGACTAGAGTTGAAAAGG + Intronic
1032573277 7:133024707-133024729 GGCTGAGACTAGATTTGAACAGG + Intronic
1037448201 8:18989235-18989257 TTCTAGGACAATTTTTGAAGTGG + Intronic
1038989762 8:32855264-32855286 ATCTAGGACTAGTGTTGAAGGGG + Intergenic
1042119067 8:65464928-65464950 TGCTAGTAATACATTTGATGAGG - Intergenic
1045935346 8:107672163-107672185 TGCTACCTCTATATTTGAAGTGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1056982106 9:91323724-91323746 AGCTAGGAATATATTTGAGGGGG + Intronic
1187754278 X:22503236-22503258 TGCTAGGAATGGAATTGATGGGG + Intergenic
1188320752 X:28734199-28734221 TGTTGAGAATAGATTTGAAGAGG - Intronic
1188879317 X:35472367-35472389 TGCTAGGACTATATTTGGCAAGG - Intergenic
1190542407 X:51491321-51491343 TACTAGCACCAGATTGGAAGGGG + Exonic
1194996022 X:100592187-100592209 TGACAGGACTGGATCTGAAGTGG + Intronic
1199160104 X:144599138-144599160 TGCAAGCACTAGTTTTTAAGAGG + Intergenic