ID: 970941614

View in Genome Browser
Species Human (GRCh38)
Location 4:21640944-21640966
Sequence AGTTATCTGCAGAGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 26, 3: 242, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970941614_970941616 4 Left 970941614 4:21640944-21640966 CCTGCCACTCTCTGCAGATAACT 0: 1
1: 0
2: 26
3: 242
4: 404
Right 970941616 4:21640971-21640993 TCCTTTTGAGAAACTGCTTTTGG 0: 1
1: 10
2: 59
3: 1065
4: 2507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970941614 Original CRISPR AGTTATCTGCAGAGAGTGGC AGG (reversed) Intronic
900897507 1:5493927-5493949 GGTTCTCTGCAGAGTGTGCCGGG - Intergenic
900923764 1:5690434-5690456 AGGTATGTGCTGAGAGTGGCTGG - Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902158659 1:14511096-14511118 AGTTATCTGCGGGGGGTGGGAGG + Intergenic
903226733 1:21898118-21898140 AGTCATCTTCACAGAGTGACTGG - Intronic
903993707 1:27291517-27291539 AGGTATCCTCAGAGAGTGGTGGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904846468 1:33422168-33422190 AGTTTTCTGGAGAAAGTGACAGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905851629 1:41279234-41279256 AGGTATTTGAAGAGACTGGCAGG + Intergenic
905867337 1:41383140-41383162 AGTTTTCCGCAGAGGGTTGCTGG - Exonic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907470800 1:54672225-54672247 AGTAATCTGCAGAGATGGGCAGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
910962475 1:92777578-92777600 AGTTGTCTGAAAAGAGTGTCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912468542 1:109890779-109890801 AATTATCTACACAGAGTGGCTGG - Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
914753972 1:150552905-150552927 AGGTGTCTGAAGAGAGTGTCCGG - Exonic
915230713 1:154443506-154443528 AGTGCTCTGCACAAAGTGGCAGG - Intronic
915447915 1:155984647-155984669 GGTTATGTGGAGACAGTGGCTGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918154372 1:181831252-181831274 AGGTAGCTTCAGTGAGTGGCTGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919659892 1:200234076-200234098 AACTATCTGTAGAGAGAGGCTGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920821036 1:209381066-209381088 AGTTGTCTGCACAGAGAGGAAGG + Intergenic
921717887 1:218437029-218437051 AGATATAAGCAGAGAGTGGCTGG - Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924183390 1:241461975-241461997 AGTTATCAGAGGAGAGTGGAGGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062791798 10:311429-311451 AGTTGAGTGCAGAGATTGGCCGG - Intronic
1063284031 10:4663250-4663272 TGCTATCTGCAGACAGTTGCTGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066218357 10:33310723-33310745 AGTCACCTTCAGAGAGTGGCTGG + Intronic
1066239830 10:33522824-33522846 AGTAATGTGCATAGAGTGCCTGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067547388 10:47203644-47203666 AGTTATCTCCAGAGTGGAGCTGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069257225 10:66347745-66347767 AGTTATCTGCAGAAATTATCTGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071239767 10:83692646-83692668 AGTTAACAGCAGACAGGGGCAGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074235655 10:111582111-111582133 AGTTATCTATAGAGAATAGCAGG + Intergenic
1074362116 10:112832149-112832171 AGTCTGCGGCAGAGAGTGGCTGG + Intergenic
1075135254 10:119779039-119779061 AGTTATCTCCACAGAGTAGGTGG - Intronic
1076123287 10:127953343-127953365 GGTTACCTGCAGGTAGTGGCCGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081888701 11:46521765-46521787 AGTTGCCAGCAGAGACTGGCAGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086209345 11:84299625-84299647 AGTGAACTGCAAAGAGTGGTAGG + Intronic
1086827320 11:91515587-91515609 ATTTATCTCCAGAGCGTGGACGG + Intergenic
1087682554 11:101232857-101232879 AGGTAGCTCCAGTGAGTGGCTGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088612508 11:111591321-111591343 AGATATCTGCAGGGAGTGTGAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089015123 11:115159372-115159394 GGTTGACTGCAGAGAGTGACAGG + Intergenic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089305174 11:117521963-117521985 AGTTCTGAGCAGCGAGTGGCTGG - Intronic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091799864 12:3318118-3318140 AGAAATCTGCAGAGAGGGGAAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095121508 12:38424871-38424893 AGTTTTCTGCAGAAAATGCCAGG + Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095394095 12:41742892-41742914 AGCTAGCTGCAGAGAGTCACAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096195200 12:49645175-49645197 AGCCATCTGCAGAGAGTGGTTGG + Exonic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097362235 12:58670781-58670803 AGTTAGATGAAGAGAGTGGGTGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098446471 12:70570827-70570849 TGATGTCAGCAGAGAGTGGCGGG - Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099316599 12:81090853-81090875 TGGTATCTGCAGGGAGTGGGTGG - Intronic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099377030 12:81904291-81904313 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100912692 12:99383423-99383445 AGGTGACTGCAGAGATTGGCAGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102827418 12:115961182-115961204 GGTTATTTGCAGAGTGTAGCAGG + Exonic
1102863350 12:116355224-116355246 AGGTAGCTGCGGAGAGTGCCTGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104754826 12:131262434-131262456 TTTGAGCTGCAGAGAGTGGCAGG + Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106652213 13:31703749-31703771 AGGTATCTGCAGTGATGGGCAGG - Intergenic
1106836836 13:33643861-33643883 AGACATCTGCTGAGAGAGGCTGG + Intergenic
1107664916 13:42678876-42678898 AGTTATCTGAACAGAGTTGGAGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109277449 13:60318388-60318410 TATTAACAGCAGAGAGTGGCTGG + Intergenic
1109933294 13:69245202-69245224 AGTTATTTGCAGATAGTGTCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112550952 13:100419835-100419857 AGTCATCTGCTGAGAGTAGGGGG + Intronic
1112838733 13:103549071-103549093 AGTTTTCTGCAGGAAGGGGCGGG + Intergenic
1113294051 13:108938544-108938566 AGTTCTCTGCAGAGAGATGTGGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113570216 13:111348408-111348430 AGTTAGGTGAAGAGTGTGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116698143 14:48202345-48202367 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1116879948 14:50156315-50156337 AGTTATGTAAAGGGAGTGGCAGG - Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117702196 14:58425260-58425282 AATTATCTGGGCAGAGTGGCGGG + Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118473612 14:66097289-66097311 TGTTATGTGCAGAGATTGGGTGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119683152 14:76607907-76607929 ATCTATCTGCAGTCAGTGGCTGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1121634622 14:95445614-95445636 AGTCTTCTGCAGAGAGTGACAGG - Intronic
1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG + Intergenic
1124349497 15:28944698-28944720 AGATACGTGCAGAGAGGGGCAGG + Intronic
1126145433 15:45469117-45469139 ACTTGTCTGCAGGGAGTGTCTGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126898839 15:53290146-53290168 AGTTAGCAGCAGAGAATGTCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127409372 15:58690634-58690656 AGATATCAGCAGAGAGAGCCAGG + Intronic
1128621904 15:69158343-69158365 AGATTCCTGCAGAGAGTAGCGGG - Intergenic
1129269743 15:74413299-74413321 AGTCCTCTGCAGAGAATGGGAGG - Intronic
1131183461 15:90256120-90256142 AGCTATGTGCAGAGAGGGCCTGG - Intronic
1131411762 15:92213367-92213389 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134182926 16:12062033-12062055 ACTTTTCTGCACAGGGTGGCAGG - Intronic
1134659352 16:15972044-15972066 AGTTATGTGCAGAGAGGGCTGGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138558749 16:57787751-57787773 ACTCCTCTGCAGCGAGTGGCAGG - Intronic
1138756205 16:59488815-59488837 AGTTATCTAAAGAGAGAGGGGGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140816909 16:78629581-78629603 AGTAAGCTGCAGAGGTTGGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146142658 17:30380747-30380769 AGCTATCTCCAGAGATGGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146610513 17:34300897-34300919 TGTCTTCTGCAGAGAGTGGGTGG - Intergenic
1147635821 17:41963206-41963228 AGGTATCTGCAGAGGGTCTCAGG - Intronic
1147973672 17:44235320-44235342 AGTATTGTGCAGGGAGTGGCAGG - Intergenic
1149074508 17:52579755-52579777 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1149454644 17:56777898-56777920 AGTTTTCTTCAGAAAGTGGATGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151257100 17:72886392-72886414 AGTGATTTACAGGGAGTGGCTGG - Intronic
1151412978 17:73943277-73943299 ATGTATGTGCAGAGAGGGGCAGG - Intergenic
1153049132 18:884672-884694 AGTCCTACGCAGAGAGTGGCAGG - Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156625197 18:38900179-38900201 AGTTCTCAGCACAGTGTGGCTGG + Intergenic
1156651728 18:39233873-39233895 AATTCTCGGCAGACAGTGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159375425 18:67586302-67586324 ACTTATCTGGTGAGAATGGCTGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161596767 19:5154609-5154631 AGTCACCTGCAGGGAGTGGGTGG + Intergenic
1163721828 19:18901541-18901563 AGTTGTTTGCAGAGCGGGGCTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165375632 19:35439767-35439789 AGGTCTCTGCAGAGAGAGGTTGG + Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927868302 2:26607040-26607062 AGTTTCCTCCAGGGAGTGGCAGG - Intronic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931469803 2:62527330-62527352 AATTGTCTGGAAAGAGTGGCTGG + Intergenic
931674064 2:64676091-64676113 AGTTATTTGCAGTGTGTGACAGG - Intronic
932408341 2:71528999-71529021 AGTTCTCTGCAGAGAGGTGATGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933858785 2:86443365-86443387 ATTTATCTGCAAAGAGTTGTAGG + Intronic
935128501 2:100244084-100244106 AGTTACAGTCAGAGAGTGGCTGG + Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935878981 2:107542213-107542235 AGTCATCTGGAAAGATTGGCTGG + Intergenic
936826363 2:116586643-116586665 AGTGATCTGGAGAGATTGGCTGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937742342 2:125370426-125370448 AGTTATCTGAATAGAGTGGAAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940826643 2:158419990-158420012 AGTTGTCAGCAGAGAGGTGCTGG - Intronic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941949696 2:171141393-171141415 AGTTACATGCAGCTAGTGGCTGG + Intronic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942976487 2:182025026-182025048 TGTTATGTGCAGAGATTGGGTGG - Intronic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943597535 2:189876201-189876223 AGTTACCTGCTGAGAGTGGAGGG + Intronic
943820996 2:192320778-192320800 ATATATATGCATAGAGTGGCTGG - Intergenic
944416040 2:199480795-199480817 AGTTATCAGAAGAGAATGCCTGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947329708 2:229015741-229015763 AATTAGCTGCACACAGTGGCGGG - Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1169388890 20:5173594-5173616 TATCATCTGCAGAGACTGGCAGG - Exonic
1169955411 20:11097518-11097540 AGTTAACTACAGAGTGTGGGTGG + Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1171414250 20:24966879-24966901 AGGCATCTGCAGTGAGTGACAGG + Intronic
1172309508 20:33906880-33906902 TGTAGTCTGCAGAGAGAGGCAGG - Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179414517 21:41187312-41187334 AGCCATCTGCAGAGAGTCACAGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180198212 21:46209745-46209767 AGACATCTCCAGAGAGTGCCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1184143540 22:42594579-42594601 ACTTAACTGCAGGGAGAGGCTGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949184736 3:1176455-1176477 GGTTAGCCGAAGAGAGTGGCTGG + Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950148900 3:10670977-10670999 AGTTTTCTGCATTGAGTGGGAGG + Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951178337 3:19628751-19628773 AGTTTTCTGAAGAGGGTAGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951571105 3:24064220-24064242 AGTTAACTGCAGAGTGTGGCAGG + Intergenic
951581449 3:24168883-24168905 AGTAATCTGCCTAGAGTGCCAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956119757 3:65954580-65954602 AGTTATCTACAGAGAGAAGGAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957994899 3:87677020-87677042 AGTGACCTGCTGAGAGTAGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958898820 3:99861534-99861556 AATCAACTGCAGAGAGTGGGAGG - Intronic
959174001 3:102881827-102881849 AATAATCTGCAGAGGTTGGCTGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960057978 3:113289570-113289592 AGCTGCCTGGAGAGAGTGGCTGG - Exonic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960452302 3:117825536-117825558 AGTTCTGTGCAGAGAGAGGGAGG - Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
962826591 3:139105023-139105045 AGTTCTGTGGAGAGAGTGGAGGG + Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964396800 3:156254347-156254369 AGGGATCTGCACAGAGTGGATGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965568159 3:170143342-170143364 AGTTAACTGTAGAGAATGCCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966734923 3:183180623-183180645 AGTTCACTGCAGAGAGAGGCAGG - Intronic
967171454 3:186826066-186826088 AGTTCACTGCGGAGAGAGGCAGG + Intergenic
968795735 4:2702988-2703010 AGTTACCTACAGGGAGTGGGTGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969444893 4:7239157-7239179 AACCTTCTGCAGAGAGTGGCAGG - Intronic
969609402 4:8218629-8218651 AGCTCTTTGCAGACAGTGGCCGG - Intronic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971001327 4:22326090-22326112 AGGTTTGTGCAGAGAGTGGCTGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971368072 4:25993560-25993582 AGAGAACTGCAGAGAGGGGCGGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975158310 4:71096229-71096251 AATTCTCTGCATAGGGTGGCTGG + Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977203187 4:94140520-94140542 AGTTCTGTGCAGAGAGAGGAAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977337380 4:95716128-95716150 AGTTATCTGCGGAGGGTGTCAGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978393232 4:108250009-108250031 GGTTGTCTGCAGAGAGAGGGAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982724022 4:158886451-158886473 AGTGGTCTGGAGAGGGTGGCAGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984345751 4:178522473-178522495 AGTGACCTGCAGCCAGTGGCCGG + Intergenic
984939143 4:184916455-184916477 AGGTAGCTCCAGTGAGTGGCTGG + Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986687092 5:10284135-10284157 CGTGAGCTGCAGAGCGTGGCCGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990156040 5:52878216-52878238 AGTCATCTGAAGAGAGTCTCAGG + Intronic
990723713 5:58729112-58729134 CGTGATCTGCAGAAAGTGCCAGG - Intronic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991037475 5:62142520-62142542 AGTTGTTTGCAAAGAGTTGCTGG + Intergenic
991114890 5:62943401-62943423 AGTTATCTGCAGAGTTCTGCAGG - Intergenic
991272893 5:64806889-64806911 AGTTAACTTCAGAGACTCGCTGG - Intronic
991667809 5:69016848-69016870 AAGCATCTGCAGAGAGTTGCTGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992050150 5:72934109-72934131 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997000568 5:129754164-129754186 GGTTATCTGCAGGGAAAGGCAGG + Intronic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997722148 5:136088081-136088103 AGCTATCTGCAGGGAGGGGCCGG - Intergenic
998774089 5:145579593-145579615 AGTTGTCTGTAGACACTGGCTGG + Intronic
998997610 5:147882840-147882862 AGTTATCTGTTCAGTGTGGCTGG - Intronic
999172411 5:149606593-149606615 AGTTACCTACAGAGGGTGGACGG - Intronic
999748295 5:154608579-154608601 GTTTATCAGCAGGGAGTGGCAGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002101016 5:176857663-176857685 AGTTCTCTCCTGAGAGAGGCAGG + Intronic
1002676057 5:180913789-180913811 AGTTATTCGTAGAGAATGGCAGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004298584 6:14436644-14436666 AGTTATCTGTGGAGACTGGCAGG - Intergenic
1004386727 6:15179484-15179506 AGGAAACTGCAGAGAGAGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006186104 6:32182542-32182564 AGTGACCTGGAGAGAGGGGCTGG - Intronic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008448854 6:51625749-51625771 TGCCATCTGCAGAGAGTGGCAGG - Intronic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013318400 6:108963372-108963394 AGTTATCTGCAGGTAGTGAGAGG - Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021189470 7:17603115-17603137 AGTTCTCTGCATAGAGAAGCAGG - Intergenic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1021563868 7:21997674-21997696 GGTTATCTACAAAGAATGGCAGG + Intergenic
1023314398 7:38920457-38920479 ACTTATCTGCACAGAATGACAGG - Intronic
1023705798 7:42940801-42940823 AGTTATCTGAGGAGAGTGGGAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025854961 7:65268702-65268724 AGTTAGCTGGAGGTAGTGGCAGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026396174 7:69956702-69956724 AGTGCTCTGTAGAGTGTGGCAGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029589043 7:101495104-101495126 CGTTATCTGCTGAGAATGTCAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1030968743 7:116027126-116027148 AGTTCTCTGCAGACATTGGCAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033007799 7:137586277-137586299 AATTAGCTGCACAGGGTGGCGGG + Intronic
1034150572 7:148911934-148911956 AGGGTACTGCAGAGAGTGGCTGG - Intergenic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1039456641 8:37711646-37711668 AGAAATCTGTACAGAGTGGCGGG + Intergenic
1040649690 8:49434018-49434040 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1040724962 8:50371116-50371138 AGTTATCTTGAGTGAATGGCTGG - Intronic
1040857289 8:51961303-51961325 AGTTCCCTGCACAGAGTGACAGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041002686 8:53467461-53467483 AGGTAGCTCCAGTGAGTGGCTGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043188865 8:77191172-77191194 AGTCATTTCCAGAGAGCGGCTGG - Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047117244 8:121857347-121857369 AGTTATCTGCATTTAGTGGGTGG - Intergenic
1047249610 8:123171759-123171781 AGTTCTCTGCAGAGACCAGCTGG - Intergenic
1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG + Intergenic
1049707695 8:144050522-144050544 GGTGGTCTGCAGAGAGAGGCGGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050598991 9:7231718-7231740 GCTTACCTGCACAGAGTGGCGGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052186412 9:25601701-25601723 AATTATGTGCATAGAGTGGCTGG + Intergenic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052467653 9:28850464-28850486 ATGTAACTGCAGAGAGTGGGTGG - Intergenic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1055347323 9:75352581-75352603 AGTTAACTGCATAGAGGGGGAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056450383 9:86710962-86710984 AGTGATCTGCAGAGCCAGGCTGG + Intergenic
1056770027 9:89471484-89471506 TGTTATCTGGAGAGTGTGGTGGG - Intronic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1057001632 9:91515168-91515190 AGTCATCTGCATTGCGTGGCTGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059204941 9:112455749-112455771 AATTATCTGCTGACACTGGCAGG - Intronic
1059319923 9:113461594-113461616 TGTTAGCTGCAGAGTGGGGCAGG + Intronic
1060364054 9:122990970-122990992 AGTTATCTGCATACATTGGAAGG + Intronic
1061826305 9:133260447-133260469 AGTCATGGGCAGACAGTGGCTGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062552456 9:137095874-137095896 AGTCATCTGCAAAGTGAGGCAGG - Intronic
1203452643 Un_GL000219v1:134434-134456 TGTTCTCTGCAGATATTGGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194833955 X:98658772-98658794 AGTTATCTGCAGAAGGTCCCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194939027 X:99987171-99987193 AGATATCTGAAGATAGTGTCAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196960344 X:120993725-120993747 AGTACTCTGCAGATACTGGCTGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198318400 X:135493551-135493573 AGGGAACTGCATAGAGTGGCAGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200275658 X:154730022-154730044 AGCAAACTGCAGAGCGTGGCAGG - Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201572816 Y:15432672-15432694 AGGTAACTCCAGTGAGTGGCTGG - Intergenic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic