ID: 970947668

View in Genome Browser
Species Human (GRCh38)
Location 4:21714314-21714336
Sequence TAGAGAGCCGAGAAATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970947668_970947670 2 Left 970947668 4:21714314-21714336 CCCTGATATTTCTCGGCTCTCTA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 970947670 4:21714339-21714361 CTCCTTTGTTCTTTGAGAGAAGG 0: 1
1: 2
2: 3
3: 80
4: 1165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970947668 Original CRISPR TAGAGAGCCGAGAAATATCA GGG (reversed) Intronic
907186668 1:52614837-52614859 TAGAGAGCTGGGGAATTTCAGGG - Intergenic
908981650 1:69966774-69966796 TAGAGAGCCGAGCAAAATACAGG + Intronic
909158302 1:72110479-72110501 TAGAGAGCAGATAATTACCATGG - Intronic
910598614 1:89006044-89006066 TAGAGAGCCGAGCAAAATACAGG - Intergenic
911630617 1:100179878-100179900 TAGAGAACCCACAAATTTCAAGG + Intergenic
914787146 1:150844476-150844498 TAGAGAGATTAGAAATATCAGGG - Intronic
915675425 1:157525688-157525710 TAGAGACCCAAGAAATATTTAGG + Intronic
916170352 1:161997323-161997345 TGGAGAGCATAGAAACATCATGG - Intronic
916519438 1:165550638-165550660 TTGACAGCAAAGAAATATCATGG - Intronic
916742900 1:167661886-167661908 TAGTGAGCACAGAAATATAATGG - Intronic
917898600 1:179517642-179517664 TAGAGAGCCGAGCAAAATACAGG - Intronic
919711212 1:200731169-200731191 AAGAGAGCACAGATATATCAGGG + Intergenic
919995383 1:202743667-202743689 TAGAGAACCCAGAAATAAAAAGG + Intronic
921300624 1:213748261-213748283 AAGAGACCCTAGAAATGTCATGG - Intergenic
923553223 1:234980577-234980599 TAGAGAGCCGAGGCAAATCCTGG - Intergenic
923654906 1:235907539-235907561 CAGAAAGCAGAGAAATGTCAAGG - Intergenic
1063396758 10:5695245-5695267 TAATGAGCCAAGCAATATCACGG - Intronic
1065091978 10:22244353-22244375 TAGAGAGCCAAGAAAGGGCAGGG - Intergenic
1073716521 10:106114533-106114555 TGGAGAGCAAAGAAATAGCAGGG + Intergenic
1078554944 11:12316906-12316928 TAGAGACCACAGAAAAATCACGG - Intronic
1080672660 11:34395283-34395305 TAGAGAGCCGAGCAAAATATAGG - Intergenic
1080693188 11:34576786-34576808 TAAAGAGCAGAGAAATGGCAGGG + Intergenic
1081562753 11:44233691-44233713 TAGAGACCTGAAAAATATGAGGG - Intronic
1085103577 11:73822535-73822557 AAGACAACCCAGAAATATCATGG - Intronic
1088124949 11:106413087-106413109 TACAGAGCCAAGAAAGAACATGG - Intergenic
1089145318 11:116325455-116325477 TAGAGACTCGAGACATCTCAAGG - Intergenic
1095464764 12:42478741-42478763 TAGAAAGGCAAGGAATATCATGG + Intronic
1096237558 12:49940006-49940028 TAGAAAGCAGAGAACTCTCAGGG - Intergenic
1097390623 12:59008007-59008029 TAGAGAATCAAGAAATAACAGGG - Intergenic
1098131568 12:67356454-67356476 TAAAGAGTTGAGGAATATCAGGG - Intergenic
1098205129 12:68101051-68101073 GAGAGAGCCTATAAATATCAGGG - Intergenic
1099944846 12:89232996-89233018 CACAGAGGTGAGAAATATCATGG - Intergenic
1100364726 12:93909522-93909544 GAGAGAGAGGAGAAATACCATGG - Intergenic
1100680910 12:96919540-96919562 TAGAGAAAAGAGAAAAATCATGG - Intronic
1103900698 12:124302410-124302432 TGGAGAGCCATGAACTATCAAGG - Intronic
1112704996 13:102058557-102058579 TAGAGAGTAGACAAATATAAAGG + Intronic
1115337621 14:32257611-32257633 TAGAAAGCAGACAAATATCAAGG + Intergenic
1124184784 15:27515148-27515170 CAGTGAGCCGAGAACTATCTCGG - Intronic
1124701658 15:31919028-31919050 TGGAGAGCCGAGACACACCATGG - Intergenic
1127525339 15:59786991-59787013 TAGAGAGCTGAGAAAAATACAGG - Intergenic
1128238618 15:66084604-66084626 TAGAGAGCCGAGTAAAATACAGG + Intronic
1129013234 15:72442004-72442026 TAGAGAGCCCAGAAATAAGGTGG - Intergenic
1144278449 17:13699740-13699762 TAGAGAGCCAAGAAAAATACAGG - Intergenic
1144317603 17:14077891-14077913 TTGAGAGCAGAGAAGGATCAGGG + Intronic
1145179703 17:20736318-20736340 TAGAGAGCAGAGGAAAAACAAGG + Intergenic
1148494239 17:48043133-48043155 TAGAGGGCAGAGAAACATGAAGG - Intergenic
1149839418 17:59945972-59945994 TAGAGAGCAGAGGAAAAACAAGG + Intronic
1151274024 17:73020431-73020453 TAAAGAACAGAAAAATATCAAGG - Intronic
1156742791 18:40352704-40352726 TACAGAGGGGAGAAATATGAAGG - Intergenic
1157718651 18:49906665-49906687 CAGTGAGCAGAGAAATAACATGG + Intronic
1159228616 18:65574548-65574570 CAGAGATCCAAGAAATTTCAAGG + Intergenic
1162752400 19:12836794-12836816 TAGAGATCCTAGAAATGTCTAGG + Intronic
1163263657 19:16205810-16205832 TACACAGGAGAGAAATATCAAGG + Intronic
1167180780 19:47901797-47901819 TAGAGAGCCTAGAACCCTCAAGG - Intergenic
937723148 2:125126744-125126766 TAGAGAGCCAAGAAAAATACAGG - Intergenic
937767734 2:125680689-125680711 TAGAGAGCCGAGCAAAATACAGG - Intergenic
941513191 2:166438806-166438828 TAGTGAGCCAAGAAATATGATGG + Intronic
943348639 2:186771729-186771751 TAGAGAGCTGAGAAAAATATGGG + Intergenic
944380634 2:199105886-199105908 TAAAGAGCCTAGAAAAATCCTGG - Intergenic
944632187 2:201638720-201638742 TAAAGAGTCCAGGAATATCATGG + Intronic
946002864 2:216497740-216497762 TAGAGGGCCAAGAAAGACCATGG - Intergenic
946057060 2:216911653-216911675 TTGAGAGCTGTGAAATATCATGG + Intergenic
1168906626 20:1409132-1409154 TACAAAGCAGAGCAATATCAAGG - Intergenic
1174351102 20:49968835-49968857 GAGAGAGACGAGAAAGAGCAAGG + Intergenic
1174581027 20:51571814-51571836 TTGGGAGCCGAGAAATATGTGGG + Intergenic
1175068962 20:56315991-56316013 TAGAGAGCCGAGAAAAATACAGG + Intergenic
1177505858 21:22016417-22016439 TAGAGAGACGAGCAATTACAGGG + Intergenic
1183096870 22:35557463-35557485 AAGAGAGATGAGAAAAATCATGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185390563 22:50559043-50559065 GAGAGAGCCAAGAAAGAGCAGGG - Intronic
949395051 3:3605996-3606018 TAGAGACTAAAGAAATATCAAGG + Intergenic
950458068 3:13104421-13104443 CAGAGAGCCCAGAAATGTAAGGG - Intergenic
951761084 3:26148242-26148264 TAGAGAGCCGAGCAAAATATAGG + Intergenic
953167830 3:40481402-40481424 TAGAAAGGGGAGAAATATCCAGG + Intronic
953620602 3:44529354-44529376 TAGGGAGGCCAGAAATATAAGGG - Intergenic
953724059 3:45382085-45382107 TAGAGTGCCGAGCAAAATAAAGG - Intergenic
953919739 3:46943602-46943624 TTGAGAGCCGAGAAAGGGCATGG - Intronic
959011337 3:101079974-101079996 TAGTGAGAAGAGAAATATCCAGG + Intergenic
959578552 3:107961162-107961184 TTGAGGGCCCTGAAATATCAAGG - Intergenic
959684676 3:109131440-109131462 TACAGAGCACAGAACTATCAAGG - Intergenic
960513013 3:118572501-118572523 TAGAGAGCCGAACAAAATAAAGG - Intergenic
962696516 3:137953041-137953063 TAGAGAGCTGAGAAATAAGATGG - Intergenic
962764471 3:138549001-138549023 TAGAGAGCTGAGCAAAATAAAGG + Intronic
963180763 3:142353507-142353529 TAGAGAACCCAGAAATAAAATGG + Intronic
964714077 3:159703585-159703607 TAGAAAGCAGAGAAGTGTCAGGG - Intronic
965802334 3:172507395-172507417 TGGAGAGCTGAGAAAGATCAAGG - Intronic
969952586 4:10853670-10853692 TAGAGAGCCCAGACCAATCAGGG - Intergenic
970947668 4:21714314-21714336 TAGAGAGCCGAGAAATATCAGGG - Intronic
974785176 4:66609932-66609954 TAGAGAGCCGAGCAAAATACAGG - Intergenic
976665287 4:87583946-87583968 TTGAGAGCCTAGGAATACCAGGG + Intergenic
978811993 4:112859898-112859920 TAGAAAGCCAACAAACATCATGG - Intronic
980578750 4:134720726-134720748 TAGAGAGCCCAGAAATAATACGG + Intergenic
982927862 4:161362417-161362439 TAGAGAGCCTGGAAACATAAAGG + Intergenic
983127247 4:163968961-163968983 TAGAGGTCCTAGAAATATCCTGG + Intronic
985430503 4:189875179-189875201 TAGAGATCAGAGAAGTGTCAGGG + Intergenic
985985515 5:3512538-3512560 TCAAGAGTCGAGAAACATCAAGG - Intergenic
989998698 5:50866628-50866650 TAGAGATACCAGATATATCATGG - Intergenic
990093041 5:52079025-52079047 TACAAATCAGAGAAATATCACGG - Intronic
990862600 5:60343687-60343709 GAGAGAGGAGAGAAATATCTTGG - Intronic
994722591 5:103398172-103398194 GAGAGAGTGGAGAAATACCAGGG + Intergenic
994971960 5:106750925-106750947 TCAAAAGCCCAGAAATATCATGG - Intergenic
995898646 5:117044292-117044314 AAGAGAGGAGAAAAATATCAGGG + Intergenic
997356056 5:133263681-133263703 TAGAGAGCAGAGAAATGGGATGG + Intronic
997636895 5:135416450-135416472 TAGACAGCCTAGAAATAGAATGG - Intergenic
1001223976 5:169928046-169928068 TAGAGAGGGTACAAATATCAGGG + Intronic
1001998073 5:176177967-176177989 TGGAGAGCAGAGAATAATCAAGG - Intergenic
1002316831 5:178349229-178349251 TTGAGACCAGAGAAATAACAGGG + Intronic
1005341054 6:24844299-24844321 GAGAGAGGCCAGAAATATCCAGG + Intronic
1011168526 6:84478959-84478981 TAGAGAGCCGAGTAAAATACAGG + Intergenic
1011233230 6:85187423-85187445 TAGAGAGCCGAGCAAAATACAGG + Intergenic
1012706808 6:102541697-102541719 TAGAGAGCCTAGAAATAATGTGG - Intergenic
1018468558 6:164075983-164076005 TAGTGTGCCAAGAACTATCATGG + Intergenic
1018653334 6:166009085-166009107 GAGACAGCCGAGAAAAATGACGG - Intergenic
1021492931 7:21239627-21239649 TAAGGAGGTGAGAAATATCAAGG - Intergenic
1022070475 7:26908741-26908763 TAGAGAGACCAGAAATATGAAGG - Intronic
1023446061 7:40232833-40232855 TAAAGAGCTAAGAAAAATCAGGG - Intronic
1023488125 7:40708835-40708857 TAGAGAGGTGAGAAATACTATGG - Intronic
1025866042 7:65381848-65381870 TAGAGAGCCCAGAAATAATGTGG - Intronic
1030564278 7:111133402-111133424 TAGAGGGCAGAGAAATGTTAAGG + Intronic
1035695783 8:1594831-1594853 TAGAGCACAGAGAAAGATCAGGG - Intronic
1039571729 8:38592508-38592530 TAGAGAGCCGAGCAAAATACAGG + Intergenic
1045936343 8:107684026-107684048 CATAGAGCCCAGAAATATGAAGG - Intergenic
1046382171 8:113465533-113465555 TAGAGATCAGGGAAATTTCATGG - Intergenic
1047105320 8:121724950-121724972 CAGAGAGCTAAGAAATATCTTGG - Intergenic
1048574255 8:135678612-135678634 TAGAGGGCAGAAAAAAATCAGGG + Intergenic
1049901883 9:176949-176971 CATAGAGCTTAGAAATATCAAGG + Intronic
1051601450 9:18878485-18878507 TAGAGAGCTGAGAAAAATGTAGG - Intronic
1051872491 9:21754626-21754648 TATAGAGCCAAGCCATATCAGGG + Intergenic
1055892407 9:81137303-81137325 GAGAGAGCTGAGAAGTATCCTGG - Intergenic
1057089356 9:92242797-92242819 TAGAGAGCTGAGGAATATGCAGG - Intronic
1058378267 9:104350051-104350073 TAGTGAGCCCATAAATATCTGGG - Intergenic
1059280524 9:113129680-113129702 GGGAGAGCCCAGAAATATTAAGG - Intergenic
1059540059 9:115121362-115121384 TAGAGACCAGAGGAATGTCATGG + Intergenic
1060336966 9:122733947-122733969 TAGAGAGCCCAAAAATAAGATGG + Intergenic
1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG + Intergenic
1186328754 X:8509728-8509750 TACAGAGCTGAGAATTATCTAGG - Intergenic
1186533423 X:10320846-10320868 TAGGGAGCAGAGAAACATAAAGG - Intergenic
1187147292 X:16648859-16648881 TTTAGAGCTGAGAAACATCAGGG + Intronic
1189835901 X:45022429-45022451 TCTAGGGACGAGAAATATCATGG - Intronic
1192713913 X:73618993-73619015 TAGAGAGCCGAGCAAAATGCAGG - Intronic
1193582012 X:83276893-83276915 AAGAGAGCAGAGAAGGATCAAGG - Intergenic
1194081460 X:89471268-89471290 CAGAGAGGGGAGAAAAATCATGG - Intergenic
1196600125 X:117591795-117591817 TGGAAAGCAGAGAAAAATCAGGG + Intergenic
1197132292 X:123019614-123019636 TAGAGAGCCGAGCAAAATACAGG + Intergenic
1197140385 X:123111248-123111270 CAGAGAGCAGAGAATAATCACGG + Intergenic
1200434132 Y:3127453-3127475 CAGAGAGGGGAGAAAAATCATGG - Intergenic