ID: 970948069

View in Genome Browser
Species Human (GRCh38)
Location 4:21718781-21718803
Sequence AGTAATGACTCTATAGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970948068_970948069 -8 Left 970948068 4:21718766-21718788 CCACAAGACAGCGCAAGTAATGA 0: 1
1: 0
2: 2
3: 4
4: 69
Right 970948069 4:21718781-21718803 AGTAATGACTCTATAGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970948069 Original CRISPR AGTAATGACTCTATAGCCAA TGG Intronic
No off target data available for this crispr