ID: 970950911

View in Genome Browser
Species Human (GRCh38)
Location 4:21754285-21754307
Sequence CTGTATAGACAAATAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970950911_970950912 -7 Left 970950911 4:21754285-21754307 CCTTGCTTTATTTGTCTATACAG 0: 1
1: 0
2: 4
3: 71
4: 433
Right 970950912 4:21754301-21754323 TATACAGCCCTTACCACTACCGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970950911 Original CRISPR CTGTATAGACAAATAAAGCA AGG (reversed) Intronic
902208733 1:14889400-14889422 CACTATAGCCATATAAAGCATGG + Intronic
902858253 1:19225033-19225055 CTATAGAGAAAAATAAAGCCGGG - Intronic
902905510 1:19553792-19553814 CTACAAAGAAAAATAAAGCAGGG - Intergenic
903701231 1:25249764-25249786 CTGTTTAGAGAAATAAAGGAAGG - Intronic
904018613 1:27443658-27443680 ATGTTCAGACAAAGAAAGCAAGG + Intronic
904483862 1:30811223-30811245 CTGTCTATGCAAATAAAGCTTGG - Intergenic
904513965 1:31038700-31038722 CAGAAAAGTCAAATAAAGCAAGG - Intronic
905816379 1:40954148-40954170 TTGCATAGAGAAATTAAGCAGGG + Intergenic
905984304 1:42264168-42264190 CAGTCTAGACAAGTAAAGCAAGG + Intronic
907539674 1:55202134-55202156 ATGAATACAAAAATAAAGCATGG - Intronic
907859199 1:58335051-58335073 CTATAAAGAAAACTAAAGCAGGG + Intronic
907902157 1:58750838-58750860 TTGTGTAGACAAATACTGCAAGG - Intergenic
908994560 1:70135763-70135785 CAGTATAGACAAATATTACAGGG - Intronic
909086367 1:71173783-71173805 CTGTGAAGAAAAATAAAGCAGGG - Intergenic
909241515 1:73220392-73220414 GGGTAAAGACAAATAAAGAAGGG - Intergenic
909333307 1:74441401-74441423 CTGTATGCATAAATAAATCATGG - Intronic
909543372 1:76815958-76815980 CTAGACAGAAAAATAAAGCAGGG - Intergenic
909868757 1:80710754-80710776 CAGTATAGAGAAATTAAGGAAGG + Intergenic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910219064 1:84871943-84871965 CTGTGGAGAAAAATAAAGCAGGG - Intronic
910314313 1:85865087-85865109 CTGGATTGAAAAATAAAGCAAGG - Intronic
911389240 1:97217963-97217985 TTTTATAGATAAATAAACCAAGG + Intronic
911890793 1:103369104-103369126 ATGAAAAGACAAATAAAACATGG - Intergenic
913041038 1:115023825-115023847 CTGTATTAAGAAAAAAAGCATGG + Intergenic
914453593 1:147815095-147815117 CTGTTAAGACAAAGAAAGAAAGG - Intergenic
915691034 1:157690952-157690974 CTATGTAGAAAAATAAAGCAAGG - Intronic
915973390 1:160369424-160369446 GTATATATACAAATAAAGTAGGG - Intronic
916400038 1:164437483-164437505 CTGGATAGAACAAAAAAGCAGGG + Intergenic
916549061 1:165832062-165832084 CTGTGTAGAAAAATAAGGCCGGG - Intronic
916957016 1:169849083-169849105 CTATGGAGAAAAATAAAGCAGGG + Intronic
917603797 1:176604239-176604261 CTAAAAAGAAAAATAAAGCAGGG - Intronic
917912394 1:179663179-179663201 GGGTATGGACCAATAAAGCAAGG + Intronic
918408856 1:184237641-184237663 CTGGGAAGAAAAATAAAGCAGGG + Intergenic
918801916 1:188983453-188983475 CTGGCTAGACTAATAAAGAAGGG - Intergenic
918876059 1:190045243-190045265 CTCTATAGACAATCAAATCAAGG + Intergenic
919688046 1:200502765-200502787 CTGTAGAGAAAAATAAAGCAGGG - Intergenic
920083597 1:203396907-203396929 GTTTAAAGGCAAATAAAGCAAGG - Intergenic
920354738 1:205362955-205362977 ATGAATAGATAAATAAAACATGG - Intergenic
920722278 1:208398993-208399015 CTATAGAGATAAATGAAGCACGG + Intergenic
921250589 1:213293978-213294000 CAGTATAAACAAAGAATGCAAGG - Intergenic
921839388 1:219812214-219812236 CTGTATAAACGAATAAAGGAAGG + Intronic
921895507 1:220395641-220395663 CTGTAGATAAAAATAAAGCAGGG - Intergenic
924035514 1:239932128-239932150 CTGTGAAGAAAAATAAAGTAGGG - Intergenic
924595135 1:245438664-245438686 ATGAATAGACAAAAAAAACATGG + Intronic
1063549537 10:7017155-7017177 TTTTATAGACAAATGAAGGAAGG + Intergenic
1063945448 10:11171710-11171732 CTGCATGGATAAAGAAAGCAAGG - Intronic
1064008229 10:11714810-11714832 CTGTTTAAAAAAAAAAAGCAGGG + Intergenic
1064276084 10:13906247-13906269 CTATATAGACAGATAAAAAAAGG - Intronic
1064860447 10:19819400-19819422 CTGAATATATAAAAAAAGCAAGG + Intronic
1065775394 10:29115123-29115145 CTGTGTAGAGAACTAAAACAAGG + Intergenic
1065899222 10:30190104-30190126 ATTTATAGACAAATAAAAGAGGG + Intergenic
1067816114 10:49477914-49477936 GTGTGGAGACAAATGAAGCAGGG - Intronic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068092982 10:52455476-52455498 CTTTGGAGAAAAATAAAGCAGGG - Intergenic
1068278053 10:54828804-54828826 TTATAAAGAGAAATAAAGCAGGG + Intronic
1068390720 10:56392775-56392797 CTGTCTAGAAAAATGAATCATGG + Intergenic
1069042692 10:63711538-63711560 CTGTAAAGACAAGTAAGACAAGG - Intergenic
1069190623 10:65483709-65483731 GTGTATAATCAAATAAAGCAGGG - Intergenic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1071049207 10:81426210-81426232 TTGTTTAGAAAAACAAAGCAAGG + Intergenic
1072316403 10:94207481-94207503 CTATATACACAAATAAATGAGGG + Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1073586261 10:104712940-104712962 CTATGGAGAAAAATAAAGCAGGG + Intronic
1074171741 10:110946509-110946531 TTGTGAAGAAAAATAAAGCAGGG + Intronic
1074486305 10:113885666-113885688 CAGCATGGACAAATATAGCAAGG + Intronic
1074629654 10:115238085-115238107 AAGAATAGACAAATAAATCAAGG - Intronic
1074901518 10:117820027-117820049 TTCTATAGACAAAAAAAGCAGGG - Intergenic
1075716503 10:124558730-124558752 CTGTAAAGAAAAACAAAACATGG - Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076431851 10:130409574-130409596 TTGTAAAGACAAACAAGGCATGG + Intergenic
1076588237 10:131564774-131564796 CTATATGGACAATTAAAGCATGG + Intergenic
1076891934 10:133289072-133289094 CTGTGTAGACAAAGACAGCTGGG - Intronic
1076891946 10:133289146-133289168 CTGTGTAGACAAAGACAGCTGGG - Intronic
1077418093 11:2435216-2435238 CTATGGAGAAAAATAAAGCAGGG + Intergenic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1079991002 11:27246979-27247001 CTGAATAGTCACAAAAAGCAGGG + Intergenic
1081704002 11:45170038-45170060 CTCTGGAGAAAAATAAAGCAAGG + Intronic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1085823863 11:79822082-79822104 CTGCAAAGACACTTAAAGCAGGG - Intergenic
1086143695 11:83526962-83526984 GTGTAAAGACAAATAAATCATGG - Intronic
1086180005 11:83939415-83939437 CAGTGTAGAGAAAAAAAGCAAGG + Intronic
1087013678 11:93536576-93536598 CTGTATACACAAATACACTATGG - Intronic
1087705368 11:101484455-101484477 CCATATAGACAAATAAAGGTAGG - Intronic
1087825517 11:102760470-102760492 CTGTGCAGTTAAATAAAGCAAGG + Intergenic
1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG + Intronic
1088217236 11:107524509-107524531 TGGTATAGAAAAATAAAGCATGG - Intronic
1089552694 11:119292836-119292858 CTGTATCGAAAAATAAAACTGGG - Intronic
1090181947 11:124707462-124707484 CTCTATAGGAAAAAAAAGCAAGG + Intergenic
1092518162 12:9237843-9237865 CTATAGAGAAAATTAAAGCAGGG + Intergenic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093947518 12:25126532-25126554 CTGGATATAAAAGTAAAGCAAGG + Intronic
1094099385 12:26744508-26744530 CTATGTAGAGAAATAAAGCAAGG - Intronic
1094438813 12:30452304-30452326 CTCTGGAGAAAAATAAAGCAAGG - Intergenic
1095260464 12:40093548-40093570 CTATAGAGAAAAATAAAGCAGGG + Intronic
1095520573 12:43059927-43059949 CTGAACAGACTAATAAAGAAGGG + Intergenic
1096890422 12:54764670-54764692 CTATAAAGAGAAATAAGGCATGG + Intergenic
1097458951 12:59835910-59835932 CTGAATAGACAAAAAAGCCAGGG - Intergenic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1098299625 12:69040673-69040695 CTGAGGAGAAAAATAAAGCAGGG - Intergenic
1098299740 12:69042298-69042320 CTGAGGAGAAAAATAAAGCAGGG + Intergenic
1098340643 12:69447444-69447466 CTATAGAGAGAAATAAAGCAGGG + Intergenic
1098570215 12:71980025-71980047 CTGTGAAGACAAATAGAGCATGG + Intronic
1098935100 12:76469706-76469728 CTGTGACGAAAAATAAAGCAGGG - Intronic
1099214174 12:79834122-79834144 TTGTGAAGAAAAATAAAGCAAGG + Intronic
1099299770 12:80877516-80877538 GACTATATACAAATAAAGCAAGG + Intronic
1100056659 12:90519829-90519851 TTATAAAGAAAAATAAAGCAGGG - Intergenic
1101092603 12:101303347-101303369 CTGTGAAGAAAAACAAAGCAGGG + Intronic
1101389164 12:104284624-104284646 CTGTAAAGACAAAATAAACAAGG + Intronic
1101607064 12:106255218-106255240 CTGGAGAGAAAAATAAAGCAGGG - Intronic
1101649014 12:106657820-106657842 CTATAAAGAAAAATAAAGCATGG - Intronic
1102101886 12:110285551-110285573 CTGCTGAGAAAAATAAAGCAAGG + Intronic
1104813191 12:131630599-131630621 CTGTATAGATAATCAAAGTAGGG + Intergenic
1105434319 13:20363605-20363627 GTGTATTGACAATGAAAGCATGG + Intergenic
1105914431 13:24900054-24900076 CATTAAAGAGAAATAAAGCAAGG + Intronic
1106532218 13:30604054-30604076 CTGTGATGAAAAATAAAGCAGGG + Intronic
1107200288 13:37706974-37706996 CTGTTTACACAAGAAAAGCAAGG - Intronic
1107605998 13:42057806-42057828 CTATAGAGAGAAATAGAGCATGG + Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1108594348 13:51937111-51937133 ATTTAAAGACATATAAAGCAGGG + Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1109254718 13:60065283-60065305 CTGCAAAGACCAATAAAGCAAGG + Intronic
1109573917 13:64228304-64228326 CTGTAATGGCAGATAAAGCATGG + Intergenic
1110080559 13:71304939-71304961 CTAAAAAGACAAACAAAGCAAGG + Intergenic
1110100447 13:71594973-71594995 CTGTGGAGAAAAATAAAACAGGG + Intronic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110292136 13:73819687-73819709 CCATATAGAAAAATGAAGCAGGG + Intronic
1110324031 13:74193474-74193496 CTGTAGAGTCAAATAAACCTGGG - Intergenic
1110463543 13:75774976-75774998 CTATGAAGAAAAATAAAGCAGGG + Intronic
1111765667 13:92524972-92524994 GTGTATTGAAAAATAAAGAAAGG + Intronic
1111941455 13:94612765-94612787 CTGTTTATAAAAATAATGCAAGG - Intronic
1112216929 13:97440787-97440809 ATGGATAGATAAATAAAGCAGGG - Intronic
1112222078 13:97501234-97501256 CTATGGAGAAAAATAAAGCAAGG + Intergenic
1112423529 13:99275653-99275675 CTGTGTAGAGAAATAAAACCTGG - Intronic
1112662579 13:101529260-101529282 CTCTAAAGAAAAAAAAAGCAAGG + Intronic
1113314008 13:109159650-109159672 CTGTGTAGAAAACTAAAGCAAGG + Intronic
1113325619 13:109278325-109278347 CTATGAAGACAAATTAAGCAAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114400028 14:22401673-22401695 CTGTATAGACAAAGAAGACTGGG + Intergenic
1115541103 14:34422185-34422207 CTTTACAGATAAAGAAAGCAAGG - Intronic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116051883 14:39814035-39814057 CAGTCTAGACCCATAAAGCACGG - Intergenic
1116498439 14:45591059-45591081 TTCTGTAGAGAAATAAAGCAGGG + Intergenic
1116560631 14:46374474-46374496 CTAGATAGACTAATAAAGAAAGG - Intergenic
1117036129 14:51731734-51731756 CAGTATAAAAAAAAAAAGCAAGG - Intergenic
1117287591 14:54301922-54301944 CTATAAAGAAAAATAAAGTAGGG + Intergenic
1117339892 14:54783982-54784004 CTATGAAGAAAAATAAAGCAGGG + Intronic
1117789240 14:59321707-59321729 TTTTATAGTCAAATAAAGAAAGG - Intronic
1117902996 14:60554677-60554699 ATGAATAGACAAATAAAACATGG + Intergenic
1118028464 14:61795459-61795481 ATGTATTAAAAAATAAAGCAAGG - Exonic
1118373545 14:65157745-65157767 CTATAGAGAAAAATAAAGCAGGG + Intergenic
1118718579 14:68577676-68577698 CTATATAGAAAAATAAAGCAGGG - Intronic
1119975415 14:79019457-79019479 CTATGAAGACAAATAAAGCAGGG + Intronic
1120138056 14:80893817-80893839 TTGGATAGACAAATAAACTAGGG + Intronic
1120183940 14:81373048-81373070 CACTAAGGACAAATAAAGCAGGG - Intronic
1121045567 14:90785211-90785233 ATGTAAAGCCAAAGAAAGCATGG + Intronic
1121941512 14:98075344-98075366 CTGTGAAGGAAAATAAAGCAAGG + Intergenic
1122106033 14:99455712-99455734 CTGTATATAAATACAAAGCAGGG + Intronic
1122501691 14:102204414-102204436 CTGTGGAGAAAAATAAACCAGGG - Intronic
1123434629 15:20246280-20246302 TTATAGAGAAAAATAAAGCAGGG + Intergenic
1124417874 15:29489127-29489149 CAGTAAAGAAAAATAAAACATGG + Intronic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1125448671 15:39784967-39784989 CTTCATAAAAAAATAAAGCAGGG - Intergenic
1125915654 15:43485099-43485121 CTGAAGAGATAAATATAGCAGGG - Intronic
1126426869 15:48537289-48537311 CTGTGTAGAAACACAAAGCAAGG - Intronic
1128432748 15:67614200-67614222 CTTTATAGACAAGGAAACCAAGG - Intronic
1128759964 15:70209837-70209859 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1128779804 15:70351903-70351925 CTGGGAAGAGAAATAAAGCAAGG - Intergenic
1128990796 15:72258417-72258439 CTATATAAACAAAGAAACCAAGG - Intronic
1129033180 15:72632857-72632879 TGGTCTAGACAAATAAAACATGG - Intergenic
1129216704 15:74104373-74104395 TGGTCTAGACAAATAAAACATGG + Intronic
1129407970 15:75331712-75331734 TGGTCTAGACAAATAAAACATGG - Intergenic
1129471134 15:75754491-75754513 TGGTCTAGACAAATAAAACATGG - Intergenic
1129733870 15:77948686-77948708 TGGTCTAGACAAATAAAACATGG + Intergenic
1129841714 15:78747317-78747339 TGGTCTAGACAAATAAAACATGG - Intergenic
1129852471 15:78801548-78801570 CTGTGGGGAAAAATAAAGCAAGG - Intronic
1130051164 15:80485143-80485165 CTAAGAAGACAAATAAAGCAGGG - Intronic
1130891682 15:88138726-88138748 CTAGAAAGACAAATATAGCATGG - Intronic
1131842209 15:96449521-96449543 CTGTGTTGACAAAATAAGCAGGG - Intergenic
1132084488 15:98896105-98896127 CTGCATACACAATAAAAGCAAGG - Intronic
1135694030 16:24571592-24571614 CTGGACAGAAAAATAAACCAAGG + Exonic
1135913927 16:26586551-26586573 CTATGAAGAAAAATAAAGCAGGG + Intergenic
1136849992 16:33604824-33604846 TTATAGAGAAAAATAAAGCAGGG - Intergenic
1137039989 16:35601712-35601734 ATGTATGGACAGAAAAAGCAAGG + Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138938746 16:61763187-61763209 CCGAATAGACAAAGAAAGCCTGG - Intronic
1139163012 16:64534375-64534397 TTGTATAGATAAAGAAAGCGAGG - Intergenic
1139184019 16:64782566-64782588 GTGAATAGATAAATAAACCATGG - Intergenic
1139232829 16:65302897-65302919 ATGAATAGATAAATAAACCAAGG + Intergenic
1140429210 16:74887317-74887339 CAGTGTAGACAAATACAGCTGGG - Intronic
1140971553 16:80018120-80018142 CTTTAAAGAAAAACAAAGCAAGG - Intergenic
1141118818 16:81335012-81335034 TTCTATGGAAAAATAAAGCAAGG + Intronic
1203111604 16_KI270728v1_random:1453277-1453299 TTATAGAGAAAAATAAAGCAGGG - Intergenic
1144635685 17:16907441-16907463 CTGTGGAGAGAAATAAAGCAGGG + Intergenic
1144693525 17:17285408-17285430 CTGTATAAAAAAACAAAACAAGG - Intergenic
1145121759 17:20266736-20266758 CCGTGGAGAGAAATAAAGCAGGG + Intronic
1145203246 17:20966242-20966264 CTGTGGAGAGAAATAAAGCAGGG + Intergenic
1146888457 17:36487935-36487957 CTCTATAAACAAACAAAGCCAGG + Intronic
1147320433 17:39642696-39642718 CTGTGAAGAAAAATACAGCAGGG + Intronic
1147675991 17:42206018-42206040 CCCTGAAGACAAATAAAGCAAGG - Intronic
1149421749 17:56518483-56518505 CTTTATGGAGAAATTAAGCAAGG - Intergenic
1150032537 17:61754504-61754526 CTATGTAGAAAACTAAAGCAAGG - Intronic
1150054256 17:61997767-61997789 CTGTAGAGACAAATAAAACTCGG + Intronic
1150175372 17:63049317-63049339 CTAGGTAGAAAAATAAAGCAAGG + Intronic
1151045378 17:70914167-70914189 ATGTATGCACAAATAAAGTAAGG - Intergenic
1151407578 17:73899363-73899385 CTGTGTAGACAAGAAAAGCCAGG - Intergenic
1153698345 18:7666684-7666706 ATGTTTAGACAAAAACAGCAGGG - Intronic
1153990209 18:10390389-10390411 CAGTATAGATCAATAAAGAAAGG - Intergenic
1155036893 18:22032131-22032153 TTTTATAGACAAATAAACTAAGG - Intergenic
1156014476 18:32532553-32532575 CTGAAGAAAAAAATAAAGCAAGG - Intergenic
1156218912 18:35031078-35031100 CTATAGAGACAACTAAAGCAAGG - Intronic
1158379592 18:56914301-56914323 CTGTGAAGAAAAATAAAGCAGGG - Intronic
1159030751 18:63228452-63228474 CTATAAAGAAAAATAAGGCAAGG - Intronic
1159181692 18:64915078-64915100 GTGTATTGTCAAATAAATCAAGG - Intergenic
1159596430 18:70386846-70386868 CTGTCTTTACCAATAAAGCATGG - Intergenic
1162933636 19:13969698-13969720 CTAAAGAGAAAAATAAAGCAGGG + Intronic
1164139683 19:22448054-22448076 CTGTCTCGAAAAAAAAAGCAGGG - Intronic
1164566830 19:29331819-29331841 CTTTACAGACAAATAAACCGAGG - Intergenic
1165412505 19:35670584-35670606 CTGTCTAGAAAAATGAAGGAAGG - Intronic
1165412538 19:35670717-35670739 CTGTCTAGAGAAACAAAGAAAGG - Intronic
1166197229 19:41215133-41215155 CAGTGAAGAAAAATAAAGCAAGG - Intergenic
1166616257 19:44250071-44250093 ATGGAAAGAAAAATAAAGCAGGG + Intronic
1166668663 19:44697017-44697039 CTGTGGAGAAAAATAAAGCAGGG - Intergenic
1167352289 19:48982859-48982881 CTGAATGAACAAATAAAACATGG - Intronic
1167531972 19:50023521-50023543 CTGTGAAGAAAAATAAAGCAAGG - Intronic
926628379 2:15114617-15114639 CTATAAAGAAAAATAAAGGAGGG + Intergenic
927832780 2:26367880-26367902 CTATGGAGAAAAATAAAGCAGGG - Intronic
928567980 2:32573034-32573056 CTATATAGAAAACTAAAGCAGGG - Intronic
928809734 2:35208533-35208555 CAGAATAGATAAATAAAGTATGG - Intergenic
929078149 2:38095572-38095594 TTTTACAGACAAATAAAGCAAGG + Intronic
929304400 2:40344423-40344445 CCGTATAGACACAAAAAGAAAGG + Intronic
929852466 2:45604786-45604808 CTATAAAGAAAAATAAAACAGGG - Intronic
930140450 2:47946336-47946358 CTATGGAGAAAAATAAAGCAAGG + Intergenic
930207325 2:48601392-48601414 CTATGCAGAAAAATAAAGCAGGG + Intronic
930298499 2:49585308-49585330 ATGAAGAGACACATAAAGCAAGG - Intergenic
930409631 2:51008378-51008400 GTGTAGAGACAAATAAAGCTTGG + Intronic
930623631 2:53670691-53670713 CTGGAGAAACAAAAAAAGCAAGG + Intronic
931403759 2:61956014-61956036 CTGTTTTTACATATAAAGCACGG + Intronic
931623731 2:64236428-64236450 CTGTCTAAAAAAAAAAAGCATGG + Intergenic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
931774569 2:65529600-65529622 CTGTACAGAAAGATAAAGGAGGG - Intergenic
932998397 2:76886097-76886119 CTGAATAGAAAATCAAAGCAAGG + Intronic
933654685 2:84878050-84878072 CTATAAATAAAAATAAAGCAGGG + Intronic
935037760 2:99395681-99395703 CTGAAAAACCAAATAAAGCAGGG + Intronic
936453539 2:112652014-112652036 CTGTGAAGAGAAATAAAGAAGGG - Intronic
936809439 2:116379420-116379442 TTGTATGGATAAATAAATCAAGG + Intergenic
938705178 2:133917583-133917605 CTTTATAGAAAATAAAAGCATGG - Intergenic
939056126 2:137366449-137366471 CTGAATACACATGTAAAGCAAGG - Intronic
939244404 2:139604712-139604734 CTGTAGTGACAAAAACAGCATGG - Intergenic
939354102 2:141078538-141078560 TTGAACAGACATATAAAGCAAGG + Intronic
939442789 2:142271625-142271647 CTGGATAGGCAACTAAACCATGG - Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
939923093 2:148141222-148141244 CTGTATAGTAAAACAGAGCAAGG + Intronic
939928455 2:148202232-148202254 CTAAAGAGAAAAATAAAGCATGG + Intronic
942349352 2:175036883-175036905 ATTTAAAGACAAATAAAACAGGG - Intergenic
942946124 2:181676054-181676076 ATGTATAGACAAACTAAGCTAGG + Intronic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943560347 2:189454093-189454115 GTCTAGAGAAAAATAAAGCAGGG + Intronic
943844366 2:192624816-192624838 TTGAATAGAAAAATAAAGTATGG + Intergenic
944152968 2:196581764-196581786 ATGTAAAGATAAATAAACCATGG + Intronic
945636616 2:212361291-212361313 GTGTCTAGACAAAGAAAGCATGG - Intronic
945760310 2:213905717-213905739 CTATGAAGAAAAATAAAGCAGGG + Intronic
945931983 2:215864458-215864480 CTGTCTAAAAAAAAAAAGCAAGG - Intergenic
946314709 2:218902959-218902981 CTATGAAGAAAAATAAAGCAAGG - Intergenic
946629205 2:221647885-221647907 CTTAATAGACAGAGAAAGCATGG + Intergenic
946963045 2:225004907-225004929 ATGATTAGAGAAATAAAGCAAGG - Intronic
1169358188 20:4925364-4925386 CTGTGAAGAAAAATAAATCAGGG - Intronic
1171471608 20:25376607-25376629 CTATAAAGAAAAATAAAGCAAGG - Intronic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1173208679 20:41014963-41014985 CATTGGAGACAAATAAAGCAGGG + Intergenic
1173673369 20:44813079-44813101 CTACAGAGAAAAATAAAGCAGGG - Intergenic
1174223121 20:48973468-48973490 CTGCAGAGAAAAATAAAGCAGGG + Intronic
1174624463 20:51902852-51902874 CTCTAAAGAAAAAGAAAGCAAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177718056 21:24866195-24866217 CTGTATTGACAAAAAAATCATGG - Intergenic
1178350116 21:31866891-31866913 CTGTGAAGGAAAATAAAGCAGGG + Intergenic
1178448977 21:32674384-32674406 CTATAGAGAAAAATAAAGCAGGG - Intronic
1178955814 21:37020893-37020915 TTTTATTGACAAATAAAGCCTGG + Intergenic
1179040299 21:37796702-37796724 CTGTATTGACAAATAATACAGGG - Intronic
1179272313 21:39861018-39861040 CTATAGACAGAAATAAAGCAAGG - Intergenic
1181765858 22:25091600-25091622 CTGCATAGAAAACTAAAGCGAGG + Intronic
1181884344 22:26008170-26008192 CACTATAGTTAAATAAAGCATGG - Intronic
1181893496 22:26085477-26085499 CTGTAGAGACAAAGAAAGAAAGG - Intergenic
1183238926 22:36641158-36641180 CTCTGCAGAAAAATAAAGCAGGG - Intronic
1183764582 22:39860043-39860065 CTGTAAAGAAAAGGAAAGCAGGG - Intronic
1183886589 22:40888588-40888610 ATGAATAGACAAATAAAATATGG - Intronic
1184301934 22:43566552-43566574 CTGTATAGACAAAGTAAGTGGGG + Intronic
1184302144 22:43567830-43567852 CTGTACAGACAAAGTAAGTAGGG + Intronic
1184574461 22:45351137-45351159 TTCTATAGAGAAAAAAAGCAGGG - Intronic
949236282 3:1812794-1812816 CTTTATAGAGAAATAAAGTTAGG - Intergenic
950337243 3:12205945-12205967 CTGTGGAGAAAAATAAAGCCAGG - Intergenic
951484650 3:23198535-23198557 GTGTGGAGATAAATAAAGCATGG + Intergenic
951557058 3:23931528-23931550 CTAAGGAGACAAATAAAGCAGGG - Intronic
951944368 3:28117907-28117929 TTATAAAGAGAAATAAAGCAGGG - Intergenic
952422345 3:33143664-33143686 CTGTGGAGAAAAATAAAGCAGGG + Exonic
952470093 3:33638940-33638962 AAGTATAGGCAAATAAAGTATGG + Intronic
952770659 3:36996989-36997011 CTGTGGAGAAAACTAAAGCAGGG + Intronic
952983899 3:38760555-38760577 ATGTATAAATAAATAAATCATGG - Intronic
953123021 3:40064369-40064391 CTTTATAGATAAAGAGAGCAAGG - Intronic
953478196 3:43224178-43224200 CTGGGTAGACACATAAAGCATGG - Intergenic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
954784327 3:53081866-53081888 CTGTAGAGAAAAATAAGCCATGG + Intronic
955040059 3:55307619-55307641 CTGTAAAGAAAAATAAATTAAGG + Intergenic
955295243 3:57728970-57728992 CTGTGGAGAAAAATGAAGCAGGG + Intergenic
955401706 3:58596354-58596376 GTTTAAAAACAAATAAAGCAAGG - Intronic
955469615 3:59273107-59273129 CTATAAAGAAAAATAAACCAGGG + Intergenic
955778386 3:62458269-62458291 CTGTATAGATGAAGAAACCAAGG + Intronic
956692314 3:71889674-71889696 CTATATAGATACATAAAGCCTGG + Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956762447 3:72455914-72455936 GTGTAAAGAAAGATAAAGCAGGG - Intergenic
957637129 3:82800838-82800860 CTTTCTAGACAAGGAAAGCAAGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
958152742 3:89712248-89712270 CTAGAAAGAAAAATAAAGCAAGG - Intergenic
958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG + Intergenic
958703790 3:97627324-97627346 CTGTGGAGAAAAATAAAGCAGGG + Intronic
958747868 3:98159331-98159353 CTTTATAAACAAAAAAACCATGG + Intergenic
958778830 3:98517419-98517441 ATGTGTAGACAAACATAGCATGG - Intronic
959181864 3:102991108-102991130 CTGTCTAGGGCAATAAAGCATGG - Intergenic
959189459 3:103091818-103091840 CTCTATAGAAAAATAAAACTAGG - Intergenic
959365345 3:105451230-105451252 CTTGAAAGAAAAATAAAGCAAGG + Intronic
959938160 3:112052115-112052137 CTATGGAGAAAAATAAAGCAGGG + Intronic
960123570 3:113972811-113972833 CTATAAAGAGAAATAAAGAAAGG - Intronic
960222905 3:115136422-115136444 CTATAAAGATAAATAAAGCATGG + Intronic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
960739954 3:120822188-120822210 CTGTGGAGAAAAATAAAGCAGGG + Intergenic
960926445 3:122799233-122799255 CTTTGGAGAAAAATAAAGCAGGG + Intronic
961069747 3:123911573-123911595 CTGTGAAGAAAAATAAAGCAGGG - Intronic
961072933 3:123953202-123953224 CTGTATATACCAAAAAAGCAAGG + Intronic
962418539 3:135206231-135206253 GTGAATGGACAAATAAACCATGG - Intronic
963119674 3:141765406-141765428 CTGTGAAGAAAAATCAAGCAGGG - Intergenic
963635171 3:147785617-147785639 CTGTAGTGACCAATATAGCATGG + Intergenic
963670944 3:148251571-148251593 CTATAAAGAAAAATAAATCAGGG + Intergenic
964036280 3:152201812-152201834 GATTATAAACAAATAAAGCAGGG - Intergenic
964245092 3:154642426-154642448 CTGTAAAGAGAGATAAGGCAAGG - Intergenic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
967159214 3:186720375-186720397 TTGTATAGACAGAAAAATCATGG + Intronic
968277003 3:197447478-197447500 CTGTAAAGAAAAATAGAGCCAGG - Intergenic
970145921 4:13035611-13035633 GTGTATAGACCAGAAAAGCAGGG - Intergenic
970438254 4:16056552-16056574 CTATAAAGAAAAATGAAGCAAGG + Intronic
970881245 4:20934745-20934767 CTATGTAGAAAAATAAAGCAAGG + Intronic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971182095 4:24338133-24338155 CTTTAGAGACAAAGAAGGCAGGG - Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
971687040 4:29784340-29784362 TTGTATAGATATATAAAGAAAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972161706 4:36235547-36235569 CCGTGGAGACAGATAAAGCAAGG - Intronic
972411490 4:38799993-38800015 CTGTAGAGAAAAATAAAGCAGGG + Intronic
972849628 4:43032887-43032909 CTAGCTAGACAAATAAAGCAAGG + Intergenic
973000460 4:44942342-44942364 CTGTGAAGTAAAATAAAGCAAGG - Intergenic
973007227 4:45028206-45028228 CTGTGGTGAAAAATAAAGCAAGG + Intergenic
974999033 4:69197275-69197297 CTGTATAGAAAAATACAACTTGG - Intronic
975215512 4:71749436-71749458 CTGTATAGACAGATAACAAAGGG + Intronic
975261788 4:72311300-72311322 CCGTATAAACAAATAAAATAAGG + Intronic
975294313 4:72714721-72714743 CTGTATAGATAAGTAAACCAAGG - Intergenic
975330228 4:73104589-73104611 CTGTATAGACAGAAAAATCCTGG + Intronic
976782290 4:88774252-88774274 CTGTGGAGAGAAATAAGGCAGGG - Intronic
976796061 4:88934212-88934234 CTGTGAAGTAAAATAAAGCAGGG - Intronic
976838037 4:89398307-89398329 GTGGATAGACAAAAAAAGCGGGG + Intergenic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
977304405 4:95304612-95304634 ATGTATAAATAAGTAAAGCAGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978039881 4:104047076-104047098 CTAAAAAGAAAAATAAAGCAGGG + Intergenic
978066770 4:104414354-104414376 CTATAGAGCAAAATAAAGCAGGG + Intergenic
978085986 4:104655632-104655654 TTGGATAGACAATTAAATCAGGG + Intergenic
978233673 4:106431449-106431471 TTTTATATACAAATAATGCAAGG + Intergenic
979682753 4:123479796-123479818 CTCTAAATACAAATAAATCAAGG - Intergenic
979824151 4:125212055-125212077 CTGTTTTGACAAATAGAACACGG - Intergenic
980602872 4:135047572-135047594 CTGTGTGGAGAGATAAAGCATGG - Intergenic
981045802 4:140263970-140263992 ATGAAGAGGCAAATAAAGCAAGG + Intronic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981617896 4:146661763-146661785 CAGTATAGACATATATAGCAAGG + Intergenic
981647776 4:147019623-147019645 CTGTGCAGAAAAATAAAGGATGG - Intergenic
982058574 4:151578863-151578885 GTGAATAGACAAATAAAGTGGGG + Intronic
982108594 4:152032811-152032833 CTTTGAAGAGAAATAAAGCAGGG + Intergenic
983019256 4:162654883-162654905 CTGTGAAGAAAAATAAACCAGGG + Intergenic
983328393 4:166290071-166290093 CTGTTTTGACAAGCAAAGCATGG - Intergenic
984008455 4:174342302-174342324 CTGTATAGAAAAAATAAGGAAGG + Intergenic
984275465 4:177604471-177604493 TCCTATAGACAAATAATGCAAGG - Intergenic
984721091 4:182973919-182973941 CTATGAAGAAAAATAAAGCAGGG + Intergenic
984993181 4:185401697-185401719 TTGTGTATACAAATAGAGCAAGG + Intronic
987435796 5:17892714-17892736 ATATATAGACAAAGAAAACAGGG + Intergenic
987622548 5:20354411-20354433 CTAAATAAATAAATAAAGCAAGG - Intronic
989949017 5:50275111-50275133 CTGAAAAGCCAAATAAAACAAGG + Intergenic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991269269 5:64760172-64760194 CTGTAAAAAGAAAAAAAGCAAGG + Intronic
992877719 5:81074300-81074322 CTGTGGAGAAAAATAAAGAAGGG + Intronic
994681456 5:102893117-102893139 CTGTACTGACAAATAAAAAAGGG - Intronic
995609471 5:113893609-113893631 CTTAAGAGACAAGTAAAGCAGGG - Intergenic
997222665 5:132181992-132182014 CTCTAAAGAAAAATAAAACAGGG + Intergenic
998553742 5:143102841-143102863 CTGTAAGGACAAAGCAAGCAAGG - Intronic
998711897 5:144835386-144835408 CTGTATAGACCAAAGAAGTAGGG - Intergenic
998731642 5:145083770-145083792 AAGTAGAGAAAAATAAAGCAGGG - Intergenic
998756358 5:145385345-145385367 TTTTATAGACAAATAACTCAGGG - Intergenic
999465926 5:151804357-151804379 CTGTATATGCAAAGTAAGCAAGG - Exonic
1001610474 5:172997411-172997433 CTGTATATGCAAAGTAAGCAAGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003998097 6:11564118-11564140 CTGAATGGATAAATAAAACATGG - Intronic
1004786896 6:18978201-18978223 GTGTAAAAATAAATAAAGCATGG + Intergenic
1005451696 6:25979416-25979438 CTCAAAAAACAAATAAAGCATGG - Intronic
1005457656 6:26036536-26036558 CTGTGGAGAAAAATAAAGAAAGG + Intergenic
1005792599 6:29320692-29320714 TTAAATAGACAAATAAATCAAGG - Intergenic
1006753396 6:36393813-36393835 CTTTGGAGAAAAATAAAGCAAGG - Intronic
1007570391 6:42885951-42885973 CTATGTAGGAAAATAAAGCACGG - Intronic
1007698600 6:43749986-43750008 CTATGCAGACAAATAAAGCAAGG - Intergenic
1009650570 6:66472535-66472557 CTATAAAGAAAAATAAAGGAGGG + Intergenic
1010393675 6:75365703-75365725 CTGTATAAACAAAAAAAAAAAGG - Intronic
1011080044 6:83479862-83479884 CTGTATAGACATATAAAATAAGG - Intergenic
1011598803 6:89041132-89041154 CTATAGAGAAAAATAAAGCAGGG - Intergenic
1011809310 6:91112103-91112125 CTTTAAAGAAAAATAAATCAGGG - Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1013117271 6:107113150-107113172 CTGTCTAAAAAAAAAAAGCACGG + Intronic
1014006598 6:116426551-116426573 CTGTAAAGGAAAATAAATCATGG - Intronic
1014980587 6:127941930-127941952 CTATGGAGAAAAATAAAGCAGGG - Intergenic
1015694610 6:135966231-135966253 CTCTAAAGACAAATCAAGTACGG - Intronic
1016470970 6:144374315-144374337 CAGTAGAGACAAAAAGAGCATGG + Intronic
1016657740 6:146541472-146541494 CTTTATAGATAGAGAAAGCAAGG + Intergenic
1017568889 6:155720553-155720575 ATGGAGAGAAAAATAAAGCATGG + Intergenic
1018045815 6:159965545-159965567 CTGTAAAGTCAAATACTGCAGGG - Intergenic
1019273529 7:164005-164027 CTGTCCAGACACACAAAGCAAGG + Intergenic
1019912318 7:4108012-4108034 CTGCATAGATAAATATCGCACGG + Intronic
1020473373 7:8565360-8565382 TTTTAAAGCCAAATAAAGCAAGG + Intronic
1022321634 7:29293405-29293427 CTGAAAAGCCAAATAAGGCAAGG - Intronic
1022553891 7:31272138-31272160 CTGTAAAGAAAAAGAAGGCAGGG - Intergenic
1022637584 7:32151507-32151529 CTGAATGGATAAATAAATCATGG + Intronic
1023359301 7:39399545-39399567 ATGAAGAGACACATAAAGCAAGG + Intronic
1023374514 7:39542679-39542701 CTATGGAGAAAAATAAAGCAGGG + Intergenic
1023741712 7:43287165-43287187 CTGTAAAGAGAAATAATACAGGG + Intronic
1026432749 7:70363976-70363998 CTGTGTACACAAATAACACAAGG - Intronic
1027194947 7:76023564-76023586 TTGTAGAGACAAAAAAAGCCGGG + Intronic
1027810888 7:82895913-82895935 CTCTATAGAAAAATACAGCCAGG + Intronic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1030078320 7:105755797-105755819 TTGTATTGTAAAATAAAGCATGG + Intronic
1030385696 7:108865365-108865387 TAGCAAAGACAAATAAAGCAAGG - Intergenic
1031045652 7:116884643-116884665 GTGAACAGACAAATAAACCATGG - Intronic
1031479016 7:122256027-122256049 CTCTGGAGAAAAATAAAGCAAGG - Intergenic
1031645995 7:124225947-124225969 ATATATAGAAAAAGAAAGCAAGG - Intergenic
1032572885 7:133019912-133019934 CTGTGTAGGCCAATATAGCAAGG - Intronic
1032690333 7:134279728-134279750 CTCTGGAGACAAATGAAGCAGGG - Intergenic
1033834978 7:145299605-145299627 CACTATAGATTAATAAAGCAAGG - Intergenic
1033986055 7:147227020-147227042 CTGTGAAAACAAATAAAGTAAGG + Intronic
1036483418 8:9157873-9157895 CTTTATATACATATAATGCAAGG + Intronic
1036542380 8:9729659-9729681 CTTTACAGATAAATAAATCAGGG - Intronic
1038598232 8:28910081-28910103 TGGTATAAACACATAAAGCATGG - Intronic
1039237108 8:35513595-35513617 CTGTAGGGAAAAATAAAGCAGGG - Intronic
1039595906 8:38789570-38789592 CTGTGGAGAAAAATAAAGCAGGG + Intronic
1040625674 8:49146990-49147012 CTCTAAAGAAAAATAAAACATGG - Intergenic
1040931505 8:52739819-52739841 CTGTGCTCACAAATAAAGCAAGG + Intronic
1041926338 8:63241412-63241434 CTGTATAGAAAAATCAATGAAGG + Intergenic
1043349833 8:79346652-79346674 TTGTAAAGAAAAATAAAACATGG - Intergenic
1043826517 8:84936142-84936164 ATGTATAGACAATGAAAGTAAGG - Intergenic
1044443843 8:92250642-92250664 CTGTTGAGAAAAATAAAGCAAGG + Intergenic
1044495592 8:92876608-92876630 CTCGAGAGACAATTAAAGCAGGG + Intergenic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1044996126 8:97839806-97839828 CTCTAGGGACAAATAAGGCAAGG + Intronic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1045353805 8:101366863-101366885 CTGTATTGATTTATAAAGCAAGG + Intergenic
1046204508 8:110975301-110975323 CTGTTTAGAAAGATAAAGGAGGG + Intergenic
1046209097 8:111043258-111043280 TAGGATAGACACATAAAGCAAGG - Intergenic
1048334930 8:133495573-133495595 CTGGGTAGACAAAGAATGCAAGG + Intronic
1049585814 8:143431884-143431906 CTGTGTAGAGAAAAAAAGCCTGG + Intergenic
1049846103 8:144802565-144802587 CTATGGAGAAAAATAAAGCAAGG + Intronic
1050111427 9:2220603-2220625 ATGTATGGATAAATAAATCATGG - Intergenic
1050456036 9:5835399-5835421 CCATAAAGAAAAATAAAGCAGGG + Intergenic
1050466399 9:5928772-5928794 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1050634919 9:7602159-7602181 CTATGGAGAAAAATAAAGCAAGG - Intergenic
1050688545 9:8199360-8199382 CTGGATAGACATATACACCATGG - Intergenic
1050980488 9:12006048-12006070 CTATATAGAGAAATAAAATATGG + Intergenic
1051033102 9:12707454-12707476 CTCTATAGACAAATAAAATCAGG + Intronic
1051651367 9:19329433-19329455 ATGAATAGACAAATAAAATATGG - Intronic
1052061312 9:23964517-23964539 ATGGAAAGCCAAATAAAGCAGGG - Intergenic
1052637976 9:31126857-31126879 CTGTTTTGACAAATATAGCTTGG - Intergenic
1052664992 9:31484355-31484377 CTATAAAGAAAAATAAATCAAGG + Intergenic
1053271549 9:36753001-36753023 GTGAATAGATAAATAAACCATGG + Intergenic
1053348116 9:37393024-37393046 CTGTATAGGGAAATCAAGGAAGG - Intergenic
1054813865 9:69455980-69456002 CTCCACAGACAAATAAAACAGGG - Intronic
1056194460 9:84215758-84215780 CTGAAGAAACAAACAAAGCAGGG - Intergenic
1056701806 9:88917518-88917540 CTGTGTAGACACAGAACGCAGGG + Intergenic
1056894195 9:90526172-90526194 CTGTATAAACTAATAAAGAAAGG + Intergenic
1058596273 9:106618918-106618940 CTGTGAAGACAATTAAAGCAGGG - Intergenic
1058748544 9:108016023-108016045 CTGTGGATAAAAATAAAGCAAGG - Intergenic
1059377322 9:113894075-113894097 TTGTATAAAAAAATAATGCAAGG - Intronic
1059659601 9:116388070-116388092 CTGTACAGACAAATAAGGGAGGG - Intronic
1059663820 9:116427063-116427085 CTGCACAGATAAATAAAGCCAGG + Intronic
1059930331 9:119254261-119254283 TTATAAAGACAAATAAATCACGG + Intronic
1059996897 9:119919526-119919548 CCATGTAGAAAAATAAAGCAGGG - Intergenic
1060928495 9:127472718-127472740 CTTGAGAGACAAAAAAAGCAAGG - Intronic
1062149105 9:135008285-135008307 CTGAATAGACAAATCAAACCCGG + Intergenic
1185850260 X:3479120-3479142 TTGAATGGATAAATAAAGCATGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186173130 X:6898529-6898551 CTTTTTAAACAACTAAAGCAGGG + Intergenic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186501828 X:10057144-10057166 CTGAATGGATAAATAAAACATGG - Intronic
1187563632 X:20426682-20426704 ATTTATAGACAAAGAAATCAAGG + Intergenic
1188263675 X:28043930-28043952 TTGTATAAACAAGAAAAGCAGGG + Intergenic
1188661902 X:32770838-32770860 CTATAAAGAAAAATAGAGCAAGG + Intronic
1189244636 X:39554092-39554114 CTGTGGAGAAAATTAAAGCAGGG + Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1191885291 X:65881793-65881815 CTATGAAGAAAAATAAAGCAAGG - Intergenic
1193335486 X:80283908-80283930 CAGTAGAGAAAAATAAAGCAGGG + Intergenic
1193599562 X:83493696-83493718 CTGTATAATCATCTAAAGCAGGG + Intergenic
1193648797 X:84103931-84103953 CTGTATAAAAAAACAAAGTAGGG - Intronic
1194504683 X:94718669-94718691 CTTAAAAGACAAATAAAACATGG - Intergenic
1194937785 X:99971518-99971540 CTATAGAGAAAAATAAAGCTTGG - Intergenic
1195438671 X:104875787-104875809 CTAAGTAGAAAAATAAAGCAAGG - Intronic
1196143556 X:112292152-112292174 CTGAATAGAGGTATAAAGCATGG - Intergenic
1196333472 X:114500087-114500109 CTGTATTGAGATATAAAGCAAGG - Intergenic
1196779172 X:119367151-119367173 TTGAATAGAAAAATAAACCATGG - Intergenic
1196991944 X:121339486-121339508 CTATATACTCAAATAAAGGAAGG + Intergenic
1199479412 X:148281763-148281785 CTCGGTAGACAAATAAAGCATGG + Intergenic