ID: 970960140

View in Genome Browser
Species Human (GRCh38)
Location 4:21861964-21861986
Sequence GTTTAAGGAGGCTTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970960140_970960146 5 Left 970960140 4:21861964-21861986 CCCTCCTCCAAGCCTCCTTAAAC 0: 1
1: 0
2: 2
3: 27
4: 266
Right 970960146 4:21861992-21862014 GCTGCTCCTTCACTACAGCCAGG 0: 1
1: 0
2: 2
3: 60
4: 1266
970960140_970960147 6 Left 970960140 4:21861964-21861986 CCCTCCTCCAAGCCTCCTTAAAC 0: 1
1: 0
2: 2
3: 27
4: 266
Right 970960147 4:21861993-21862015 CTGCTCCTTCACTACAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970960140 Original CRISPR GTTTAAGGAGGCTTGGAGGA GGG (reversed) Intronic
901106125 1:6758061-6758083 CTTTGGGGAGGCTTGGATGAGGG + Intergenic
901534078 1:9871438-9871460 GTTTAAGGAGGGTGGGAGTGGGG - Intronic
901736348 1:11314712-11314734 GTTCAGGGAGGCAGGGAGGAAGG - Intergenic
903152928 1:21425648-21425670 ATTTCAGGAGGCCTGAAGGATGG + Intergenic
903160203 1:21482333-21482355 ATTTCAGGAGGCCTGAAGGATGG - Intronic
904372491 1:30058732-30058754 GTTTAAGAAGTCATGGAGGAGGG + Intergenic
905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG + Intronic
906694411 1:47814474-47814496 CTTTGGGGAGGCATGGAGGAAGG + Intronic
908043948 1:60148030-60148052 ATCTAATGAGGCTTGGAGGCTGG + Intergenic
911098927 1:94078569-94078591 GAGTAAGGGGGGTTGGAGGATGG - Exonic
912590775 1:110817595-110817617 GTAAGAGGAGGGTTGGAGGAGGG - Intergenic
913702150 1:121384017-121384039 CTTTATGGGGGCTTTGAGGAGGG - Intronic
914042708 1:144064486-144064508 CTTTATGGGGGCTTTGAGGAGGG - Intergenic
914135378 1:144896002-144896024 CTTTATGGGGGCTTTGAGGAGGG + Intronic
915729336 1:158042103-158042125 GTCACAGGAGGCTTGGAGGGAGG + Intronic
917543827 1:175941600-175941622 GTTTATGGAGACTTGGAGTGAGG - Intergenic
917609191 1:176669015-176669037 GTTGAGGGAGGATGGGAGGATGG + Intronic
918234663 1:182569250-182569272 GTTTAGGGAGGCGTAGAGGAGGG - Intergenic
919376723 1:196803984-196804006 ATTTAAGGAGGATAGGATGAAGG - Intergenic
919386429 1:196928864-196928886 ATTTAAGGAGGATAGGATGAAGG - Intronic
920026976 1:203006243-203006265 GTGTAAAGAGGCTTGGGGGAAGG - Intergenic
920182791 1:204142912-204142934 GTATCTGGAGGCTTGGAGGGAGG - Intronic
920255640 1:204652283-204652305 GTTCAGGGAGGCAAGGAGGAAGG - Intronic
920489571 1:206402732-206402754 CTTTATGGGGGCTTTGAGGAGGG - Intronic
920754434 1:208715694-208715716 TTTTAGGGAGCTTTGGAGGAGGG - Intergenic
921880555 1:220250152-220250174 CATGAAGGAGGCCTGGAGGAAGG + Intronic
924002151 1:239566207-239566229 AATTAAGGATGCTTGGAGGCCGG - Intronic
1063361546 10:5463270-5463292 GTTGAGGGTGGCTTAGAGGAAGG - Intergenic
1066293921 10:34037664-34037686 GATTTAGGAGGCTTGGGGAAAGG - Intergenic
1068990197 10:63142261-63142283 GATTCAGGAGGTTTGGAGTACGG - Intronic
1070484299 10:76914796-76914818 TTTTGAGGGGGCTGGGAGGAAGG - Intronic
1072228054 10:93388203-93388225 GTTTGTGGAGGCTGGGAGGTGGG + Intronic
1072424714 10:95320330-95320352 GTTCAACGTGGCTTGGAGAAGGG - Intronic
1072683975 10:97526553-97526575 GTTTAAGGAGTCTTGAATGAAGG - Intronic
1072758461 10:98036592-98036614 GTGTGAGGAGGGGTGGAGGAGGG + Intergenic
1073604841 10:104883785-104883807 CTCTAAGGAGGCTGGGAGGTAGG + Intronic
1073869230 10:107843411-107843433 GTTAAAGTAGGATGGGAGGAGGG - Intergenic
1075495284 10:122914479-122914501 GTTCCAGGAGGCTTAGGGGAAGG - Intergenic
1076614282 10:131745879-131745901 GTACCAGGAGGCTTGAAGGAGGG + Intergenic
1079283133 11:19105908-19105930 TTTTAAGGAGGCTTGGACACTGG + Intergenic
1079342629 11:19625217-19625239 GACTAAGAAGGGTTGGAGGAAGG - Intronic
1081871335 11:46383913-46383935 GTTTCAGGGGGCTTGGTGGTGGG + Intergenic
1082632769 11:55560808-55560830 GTGAAAAGAGGCTTGGAGGAGGG - Intergenic
1083283868 11:61645150-61645172 GCTTGAGGAGTCTTTGAGGAGGG - Intergenic
1083304590 11:61755821-61755843 GTGCAGGGAGCCTTGGAGGATGG + Intronic
1085792321 11:79506802-79506824 ATGTAAAGAGGCTTGGGGGAAGG - Intergenic
1087235919 11:95718472-95718494 GTTTCAGGTGGATGGGAGGATGG - Intergenic
1090203694 11:124873427-124873449 GTTGAAGCAGGTTTGGAGGAAGG - Intronic
1090309054 11:125718655-125718677 GCTTCAGGAGGCTGGGAGAAAGG + Intergenic
1090635738 11:128689623-128689645 GTTTGGGGCGGCTGGGAGGAGGG + Intronic
1090787590 11:130063816-130063838 GGTTTAAGTGGCTTGGAGGAAGG - Intergenic
1091805109 12:3350332-3350354 CTTTTAGTAGACTTGGAGGAGGG + Intergenic
1091818862 12:3459472-3459494 GTCAAAGGAGGCTTTCAGGAGGG - Intronic
1091931011 12:4395332-4395354 GTAAAAGAAGGCTTGGAGGCTGG + Intergenic
1091952760 12:4608605-4608627 GTTTAAGGAGTCCTGGGAGAGGG - Intronic
1092926272 12:13275348-13275370 GTTCAAGGACTATTGGAGGAGGG - Intergenic
1093799032 12:23349449-23349471 ATTTAAGGAGGTTAGGAGGTTGG + Intergenic
1094310484 12:29075260-29075282 GTATAAAGAGGCTTTGAGAATGG + Intergenic
1094487811 12:30938827-30938849 CTTTTAGTAGGCTTTGAGGAGGG - Intronic
1095650040 12:44596852-44596874 TTACAAGTAGGCTTGGAGGATGG - Intronic
1096509980 12:52122271-52122293 GGTGAAGGAGGCTGGGAGCAGGG + Intergenic
1097086473 12:56472087-56472109 GGTTAAGGAGGGGAGGAGGAGGG - Exonic
1097366494 12:58719903-58719925 TTTTAAAGAGGCTTGGATTAGGG + Intronic
1098386117 12:69920601-69920623 GTTTAAGGAAGGTGGGAGCAGGG + Intronic
1099246624 12:80200509-80200531 GCTCAAGGAGTCTTGGATGAGGG - Intergenic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1101089789 12:101273548-101273570 GATTCAGGAGGGTTGGAGCAGGG + Intergenic
1101569260 12:105937965-105937987 GGTTTGGGAGGGTTGGAGGATGG - Intergenic
1102606432 12:114071241-114071263 TTGGAAGGAGGCTTAGAGGAAGG - Intergenic
1103571516 12:121848121-121848143 GTCCAGGGAGGCTTGGAGGAAGG - Intronic
1105828620 13:24144471-24144493 ATTTAAGAAGCGTTGGAGGATGG + Intronic
1108180694 13:47837089-47837111 GCTCAGGGAGGCCTGGAGGAAGG - Intergenic
1110718524 13:78734989-78735011 GTTTTATTAGGCTTGGAAGATGG + Intergenic
1111362861 13:87198273-87198295 ATTTAAGGAGCATTAGAGGAAGG + Intergenic
1111444161 13:88323680-88323702 ATGTAAGGAGACTTGGAGGCCGG - Intergenic
1112443317 13:99441427-99441449 GGTTTAGGATGCTGGGAGGATGG - Intergenic
1112496372 13:99908295-99908317 GTGAAGGGAGGTTTGGAGGAGGG + Intergenic
1112610403 13:100949503-100949525 GGTGAAGGAGGGCTGGAGGATGG + Intergenic
1113374541 13:109752138-109752160 GCTTAAGGAAGGTTTGAGGAAGG + Intergenic
1114317646 14:21523131-21523153 GTTTTAGGAGGCAAGGAAGAGGG - Exonic
1114928192 14:27431897-27431919 TTTTAAGGAGACCTGGAGGCCGG - Intergenic
1115961187 14:38837407-38837429 GCTGAATGAGGCTGGGAGGATGG - Intergenic
1116780409 14:49231047-49231069 GGTTTCTGAGGCTTGGAGGAAGG - Intergenic
1117262890 14:54055005-54055027 GGTTACGGGGGCTAGGAGGAGGG + Intergenic
1118836269 14:69480211-69480233 GTGGAAGGAGGCTTGGAGGAGGG + Intergenic
1119141225 14:72269150-72269172 GATGATGGAGGCTTGGAGCAAGG - Intronic
1119529198 14:75347811-75347833 GTTTAGGCAGGCGTGGAGGTGGG + Intergenic
1119637178 14:76283370-76283392 TTTTAAGGAGGGAGGGAGGAGGG + Intergenic
1120759379 14:88272117-88272139 GAGGAAGGAGGCTTGGAGAAGGG - Intronic
1120962751 14:90140230-90140252 ATTTAAGGAGCCTTGCATGATGG - Intronic
1122440271 14:101727025-101727047 GAGTAAGGAGGCCTGGAGGTGGG - Intergenic
1124668004 15:31610192-31610214 GTTAAAAGAGACATGGAGGAGGG + Intronic
1127829005 15:62733318-62733340 GTTTCAGGAAGGTTGGAGAATGG + Intronic
1128611732 15:69079306-69079328 GTGTAGGGAGACTTGGAAGAAGG + Intergenic
1128789259 15:70420849-70420871 GCTTAAGCAAGCCTGGAGGAAGG - Intergenic
1131907004 15:97153594-97153616 TTATAAAGAGGCTTGGAGGTAGG - Intergenic
1134049001 16:11123833-11123855 GATGAAGGTGGCCTGGAGGATGG - Exonic
1134228492 16:12410847-12410869 GCTTCAGGTGGTTTGGAGGATGG + Intronic
1134880620 16:17742574-17742596 GATTCAGGATGCTTCGAGGAGGG + Intergenic
1136262668 16:29091570-29091592 GTTTAAGGAGGCCTGCACTAAGG + Intergenic
1136481065 16:30542135-30542157 ATGTAAAGAGGCTTGGGGGAAGG + Intronic
1136482142 16:30548692-30548714 ATGTAAAGAGGCTTGGGGGATGG + Intronic
1137655483 16:50154429-50154451 GGCTAAGGAGGCTTGGGGAAAGG - Intronic
1138595813 16:58028374-58028396 GTTTAAGGAGCCTTGAATGTTGG + Intronic
1140213878 16:72992210-72992232 TTCTCAGGAGGCCTGGAGGAAGG - Intronic
1140543799 16:75786995-75787017 CTTTAAAGAGGGTTGGAGGTGGG - Intergenic
1141878487 16:86842371-86842393 GTGTGAGGATGCTTGAAGGAAGG + Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1144078029 17:11736484-11736506 CTTTCAGGATGCTTGGAGGCAGG - Intronic
1144290493 17:13821657-13821679 TGTTAAGAAGGCTTGGAGGCTGG - Intergenic
1145885995 17:28382922-28382944 TTTTGTGGAGGCTTGGAGGTTGG + Intronic
1145981182 17:29012669-29012691 GTTCAAGGAGGAGTGGGGGAGGG - Intronic
1147200503 17:38798769-38798791 AGGTAAGGAGGCCTGGAGGATGG + Intronic
1148523790 17:48309904-48309926 CTTTAATGAGGCTTGGAATAAGG + Intronic
1150001389 17:61443063-61443085 GGTCAAGGATGCTTGGGGGAGGG + Intergenic
1151388646 17:73770838-73770860 GATGAAGGAGGGCTGGAGGAGGG + Intergenic
1152285070 17:79407740-79407762 ATTCAAGGTGGCTTGGGGGAAGG + Intronic
1156023041 18:32621170-32621192 GTTTAAGGGGGAATGGATGATGG + Intergenic
1156079334 18:33315180-33315202 GTCTAGGGAGACTTTGAGGAGGG - Intronic
1156546887 18:37972533-37972555 GTCTAATGAGACTTGGAAGAAGG - Intergenic
1157257768 18:46153647-46153669 CTTTAAAGATGCTTGGAGAATGG + Intergenic
1158097807 18:53794180-53794202 GTTTAAGGAGGCTAAAAGTAGGG - Intergenic
1159021483 18:63146499-63146521 GTTAAAGGAGGCTTGTAGAGCGG - Intronic
1160080045 18:75717733-75717755 GACGAAGGAGGCTTGGACGATGG - Intergenic
1161153940 19:2722676-2722698 GTGGAAGGAGGGCTGGAGGAAGG - Intronic
1162867808 19:13562130-13562152 GTCTAGGGTGGCTTGGAGGAAGG - Intronic
1163100409 19:15092382-15092404 GTTTAAGGAGGATAGGGGGTGGG + Intergenic
1163208188 19:15819608-15819630 GCTTAAGGAGACTTGGAGGGTGG + Intergenic
1164571617 19:29378832-29378854 GTTTGGGAAGGCTTGGAGGCTGG + Intergenic
1165526014 19:36355329-36355351 GTTAAAGGAGGCCTAGAGGAGGG + Intronic
1165578172 19:36839042-36839064 CTTTAAGGGCGATTGGAGGATGG - Intronic
1165746323 19:38231997-38232019 GGTTGAGGAGGGATGGAGGAGGG - Intergenic
1168069959 19:53943588-53943610 TTTTAACGAGGCTGGGGGGAGGG + Exonic
1168138236 19:54366100-54366122 GGTTACGGGGGCTGGGAGGAGGG + Intronic
1168159710 19:54501961-54501983 GGTTACGGGGGCTGGGAGGAGGG - Intronic
925650193 2:6081219-6081241 GTTTATCGTGTCTTGGAGGAGGG + Intergenic
928163304 2:28949915-28949937 GATTAAGGAGGCTGGGAGTTAGG + Intergenic
929091056 2:38217737-38217759 TTTGAAGGAGGCATTGAGGATGG - Intergenic
929909585 2:46078157-46078179 GTTCAAGGTGGATTGGAAGAAGG - Intronic
930317013 2:49810261-49810283 GTTTTAGGAGGCTGGGAGCTAGG - Intergenic
930380307 2:50619865-50619887 GTTTATGTAGGATTGGGGGAGGG - Intronic
932614064 2:73220765-73220787 GCTTCAGGAGGCATGGAGGTAGG + Exonic
933625458 2:84592912-84592934 GTTTCCAGAGGCTGGGAGGAAGG + Intronic
934654231 2:96108936-96108958 GCAACAGGAGGCTTGGAGGAGGG + Intergenic
935063322 2:99626719-99626741 GTTGATGGAGGCTGGGAGGAGGG - Intronic
935595841 2:104876895-104876917 GGTTCAGGGGGCTTGAAGGAAGG + Intergenic
935785158 2:106542029-106542051 GTTTATGGAGAGTTGGAAGAAGG - Intergenic
937867174 2:126761253-126761275 GTTTGAGCAGGCTGGGATGAGGG - Intergenic
941569882 2:167156934-167156956 GTTCAATGGGGCTTGGAAGAGGG - Intronic
942855159 2:180536806-180536828 GTTTAAAGAGATTTAGAGGAAGG + Intergenic
942903835 2:181157061-181157083 GTTGAAGGAGGCCTGGTGGAAGG - Intergenic
943865730 2:192922905-192922927 TTTTAAGTAAGCATGGAGGAGGG - Intergenic
945322503 2:208441369-208441391 ATTTACGGAGGCTTGCAGGAAGG - Intronic
948084099 2:235232091-235232113 ATTTCAGCAGGCCTGGAGGAGGG + Intergenic
948752030 2:240138459-240138481 CTTTGAGGATGCTGGGAGGAAGG - Intergenic
1169805652 20:9556817-9556839 GTTTCCTAAGGCTTGGAGGAGGG - Intronic
1172257181 20:33529382-33529404 GTTGAAAGAGGCTTGATGGAAGG - Intronic
1172613624 20:36268921-36268943 CTCTATGGAGGCCTGGAGGAAGG + Intronic
1174413649 20:50352755-50352777 GTTTGGGGAGGCTGGGATGAGGG + Intergenic
1179126325 21:38594430-38594452 GTTAAAGGATGCTTTGATGATGG - Intronic
1180992003 22:19942330-19942352 GTTGCAGGAGGCCTGGGGGAGGG + Intronic
1181235818 22:21447052-21447074 GTTGCAGGCGGCTTGGAGAAAGG + Exonic
1181572175 22:23773506-23773528 GTTTTGGGAGGCTTGGAGCCAGG + Intronic
1181587769 22:23863160-23863182 GTGGAAGGAGGCTTAGAGGAAGG - Intronic
1182020104 22:27074527-27074549 GTTTTAGGGGACTGGGAGGAAGG + Intergenic
1182682907 22:32096387-32096409 GTATAAGGAGCCTTGGACAAGGG - Intronic
1182755713 22:32677197-32677219 GATTAAGGAGGCTTAGAGGAAGG + Intronic
1183387494 22:37523475-37523497 GTTGAAGGAGGATTGGAAGGGGG + Intergenic
1184059052 22:42070914-42070936 GCTTAGGGAGGCTGGGAGGCCGG - Intergenic
1184420796 22:44381860-44381882 GTCTAAGGAGGGTGAGAGGAAGG - Intergenic
950555082 3:13690464-13690486 GTTCAAGGAGGCTTGGCCAAGGG - Intergenic
950723234 3:14899306-14899328 GTTTATGGAGCAGTGGAGGATGG - Intronic
950733033 3:14979196-14979218 GTTTAAGGTGGCTTGGTAAAGGG + Intronic
951879868 3:27469972-27469994 GTTAAAGGAGGCTTGAAAGAAGG - Intronic
952885477 3:38009003-38009025 GCTGGAGGAGGCCTGGAGGAGGG - Intronic
953140857 3:40228058-40228080 TTTTGGGGAGTCTTGGAGGAGGG + Intronic
953334533 3:42082798-42082820 GTTAAAGAAGGCTTGAATGAGGG + Intronic
954277230 3:49550475-49550497 GTTCAAGGAGCCTTGTAGGCAGG + Intergenic
954892035 3:53939495-53939517 ATTTAGGGATGCTTGGTGGAAGG + Intergenic
956746195 3:72312675-72312697 GGTTTTGGAGGCCTGGAGGATGG + Intergenic
959534440 3:107469513-107469535 GTTTCAGATGGCTTGGAGGAAGG + Intergenic
963108255 3:141664677-141664699 GTGGAAGGAGGCTTGGGGGAAGG - Intergenic
965581178 3:170269363-170269385 ATTTAAGAAGGCTTTGAGGCTGG + Intronic
966306679 3:178543968-178543990 GTTTAAGGAGGGGTGGAAGGAGG - Intronic
966839088 3:184074016-184074038 GTTTCAGAAGTCTTAGAGGAAGG - Intergenic
969282447 4:6179776-6179798 TTACAAGGAGGCTTTGAGGATGG - Intronic
969849742 4:9946983-9947005 CCTAAAGCAGGCTTGGAGGAAGG - Intronic
970560848 4:17280721-17280743 GTTTAAGGCCTCTGGGAGGAGGG - Intergenic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
972015362 4:34236515-34236537 GTTTCTGGAGGCTTGGGGGAGGG + Intergenic
973650049 4:52989957-52989979 GTTGAAGGAGGCATGAAGGATGG - Intronic
975093506 4:70430653-70430675 GTTTGACCAGACTTGGAGGAAGG + Exonic
975224658 4:71857932-71857954 ATGTAAAGAGGCTTGGGGGAAGG - Intergenic
977575711 4:98672016-98672038 TTTTAAGGAGACATGGAGCAAGG - Intergenic
980443736 4:132881225-132881247 GTTTAAGGATGGTTGGAAGGGGG - Intergenic
984791702 4:183620740-183620762 ATTTACGGAGGATTGGTGGAAGG + Intergenic
984820750 4:183879765-183879787 TTTGGAGGAGGCTTGGGGGATGG + Intronic
987699872 5:21383461-21383483 ATTTCAGGAGGGTGGGAGGAGGG - Intergenic
988565335 5:32316318-32316340 ACTTAAGAAGGCTTGGAGGCCGG + Intergenic
988592414 5:32560564-32560586 GCTTAAGGAGGATTGGAGTTGGG - Intronic
988752533 5:34204590-34204612 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
989070896 5:37510252-37510274 GTTGAGGGAGGAATGGAGGAGGG - Intronic
989521187 5:42402742-42402764 TTACAAGGAGGCTTTGAGGAAGG - Intergenic
989989653 5:50746260-50746282 GCTTAAGGATGCTTGGGTGAAGG + Intronic
991740300 5:69665404-69665426 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
991757198 5:69887763-69887785 ATTTCAGGAGGGTGGGAGGAGGG - Intergenic
991791875 5:70245145-70245167 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
991819763 5:70541521-70541543 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
991836601 5:70763645-70763667 ATTTCAGGAGGGTGGGAGGAGGG - Intergenic
991884324 5:71245483-71245505 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
994634331 5:102325318-102325340 GTTTATGGGGGCAGGGAGGAAGG + Intergenic
995804817 5:116039253-116039275 GTTGAAGGATGATAGGAGGAGGG - Intronic
995971840 5:117982150-117982172 TTTTATGGAGGGTAGGAGGAGGG + Intergenic
998190946 5:140024093-140024115 GTCTCAGGAGTCTTGGGGGAGGG - Intronic
998864593 5:146484843-146484865 GTTTATGGTGGCTTGGATTAGGG - Intronic
999498244 5:152121307-152121329 CTTAAATGGGGCTTGGAGGATGG + Intergenic
999547766 5:152649706-152649728 GCTTAAGGAGGCTATTAGGAAGG + Intergenic
1000527965 5:162382046-162382068 GTTTAAGGATGCTTTAAGGATGG + Intergenic
1000653679 5:163849765-163849787 GCTCAAGGTGGCTTTGAGGAAGG + Intergenic
1001436352 5:171702592-171702614 GTGTAAGGAGCCTTGGAGCCAGG + Intergenic
1001654145 5:173336514-173336536 GTTAACTGAGGCTTGGAGGGTGG - Intergenic
1002496513 5:179616648-179616670 GTTTAAGTAGTCTTGGGGGAGGG - Intronic
1003447807 6:6200675-6200697 GTTCATGGAGGAATGGAGGAAGG + Intronic
1004180397 6:13376184-13376206 GTCTAAGGAGGCAGGGAGGTGGG + Intronic
1005550697 6:26911310-26911332 ATTTCAGGAGGGTGGGAGGAGGG + Intergenic
1006470043 6:34223663-34223685 GTATTAGGAGGCTGGGCGGAGGG - Intergenic
1007060935 6:38940382-38940404 GTTTGAGGAGGGTTGGAGTGGGG + Intronic
1007301781 6:40873177-40873199 GAGGAAGGAGGCTGGGAGGAAGG - Intergenic
1011210830 6:84954722-84954744 CTTTGACGAGGGTTGGAGGAAGG + Intergenic
1012183864 6:96189324-96189346 GCTTAAGGAGCCCTGGATGATGG - Intronic
1015791441 6:136968107-136968129 GTTAAAGAGGGCTGGGAGGAAGG + Intergenic
1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG + Intronic
1017286245 6:152679847-152679869 GGTTAAGGAGACCTGGATGAGGG - Intergenic
1020227729 7:6293436-6293458 GTTGTAGGGGGCTGGGAGGAAGG - Intergenic
1020316779 7:6911123-6911145 GTTTAAGGAAACTTCGAGGATGG + Intergenic
1021709109 7:23397526-23397548 GTTGAAGGAGGCATGGCGTATGG - Intronic
1021747041 7:23751952-23751974 GTTTCTGGGGGCTTGGGGGAGGG + Intronic
1021751226 7:23802448-23802470 ATGTAAAGAGGCTTGGGGGAAGG + Intronic
1021883684 7:25117610-25117632 GTTTTAGAAGGCACGGAGGAAGG + Intergenic
1022665127 7:32403645-32403667 GTTTTAGGATGATTGGAGAAGGG - Intergenic
1023113741 7:36840102-36840124 GTTTAAAGAGGCTTTAAAGAGGG + Intergenic
1023704126 7:42922084-42922106 TTTTAAGAAGGCTAGAAGGATGG + Intronic
1023785270 7:43701263-43701285 GTTGATGGAGGATTTGAGGATGG - Intronic
1025820772 7:64960835-64960857 ATTTAAGGAGGCTTGAAGATAGG - Intergenic
1026280310 7:68916353-68916375 GGTTAAGAATGCTGGGAGGAGGG + Intergenic
1026554304 7:71392477-71392499 GCTTCAGGAGGCTTGGGGTAAGG + Intronic
1027860678 7:83575223-83575245 GTTGAAGGAGGGTAGCAGGATGG + Intronic
1028990130 7:97040328-97040350 GTGTCAGAAGGGTTGGAGGAAGG + Intergenic
1029472261 7:100762043-100762065 GGGGAAGGAGGCTTGGGGGAGGG + Intronic
1029665427 7:101992147-101992169 GTAGAAAGAGGCTTGGAGGGGGG + Intronic
1030113039 7:106042608-106042630 GTTGAAGGAGGCCTCTAGGATGG + Intergenic
1032198834 7:129805098-129805120 GATGAAGCAGGCCTGGAGGATGG + Intergenic
1032913650 7:136462497-136462519 ATTCATGGAGGCTTGCAGGAAGG + Intergenic
1033000131 7:137494404-137494426 GTTTAAGGAAGCTAGAAAGAAGG + Intronic
1033729370 7:144159903-144159925 GTTCCAGGAGTTTTGGAGGAGGG - Intergenic
1035867321 8:3099095-3099117 ATGTAAAGAGGCTTGGGGGAAGG - Intronic
1037598086 8:20371118-20371140 GTGTAAGGGGGCTGGGAAGACGG + Intergenic
1037846028 8:22283027-22283049 ATTTCAGGACGCTTGGAAGAGGG + Exonic
1038626657 8:29200533-29200555 ATTTGAGGAAGCTTGGAGAAGGG - Intronic
1041868221 8:62601316-62601338 GTTTAAAGAGGAATGGAGGTAGG + Intronic
1042640001 8:70923412-70923434 GGTTCAGGAGACTTGGGGGATGG - Intergenic
1044019669 8:87089567-87089589 CTTTAAGGAAGGTTGGAAGACGG + Intronic
1044184531 8:89236081-89236103 TTGTAAGAAGGCTTAGAGGAAGG + Intergenic
1045333612 8:101179117-101179139 GTTAAAGAAGGCATGGAAGATGG - Intronic
1045357693 8:101404111-101404133 GGTAAAGAAGGCATGGAGGAAGG - Intergenic
1046617293 8:116491247-116491269 GTTTATGAAGGGTTGGGGGATGG - Intergenic
1046696103 8:117341275-117341297 GTTACCGGAGGCTAGGAGGAAGG + Intergenic
1046969197 8:120202508-120202530 GTTTGATGAGGCTTGGAGAAGGG + Intronic
1048765606 8:137841153-137841175 GTTTTAGGAGGCTTGAAGCATGG + Intergenic
1049362694 8:142219806-142219828 GGTGAAGGAGGCTGGGAGGCCGG - Intronic
1056897346 9:90563424-90563446 GTTTTAGTAGGAATGGAGGATGG - Intergenic
1058164859 9:101607680-101607702 GTTGAAGTAGGCTTCAAGGATGG + Intronic
1059403102 9:114082794-114082816 TTTTAAGTAGGCTTGGGGCAAGG - Intergenic
1060365701 9:123011074-123011096 TTTTAATGAGGCATGAAGGAAGG + Intronic
1060551310 9:124486684-124486706 GTTCAGGGAGGCTTGGGGAAGGG - Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1187037951 X:15562099-15562121 TGTTAAGGAGGCTGGGAGGGAGG + Intronic
1187821724 X:23295046-23295068 GGGTAAGGAGGGTTTGAGGAGGG - Intergenic
1189780985 X:44514210-44514232 GTCAAAGGAGCCTTGGAGAAAGG + Intergenic
1189833829 X:45001109-45001131 TTGGAAGGAGGCTTAGAGGAAGG + Intronic
1190596685 X:52059314-52059336 GTCTCAGGAGGCTGGGAGGGCGG + Intergenic
1190612139 X:52194759-52194781 GTCTCAGGAGGCTGGGAGGGCGG - Intergenic
1190865999 X:54385098-54385120 TTTTATGGAGGTTTGGAGGCTGG + Intergenic
1193473746 X:81938954-81938976 ATTAAATGAGGCTTGGAGAATGG + Intergenic
1193799479 X:85917293-85917315 GTCAAGGGAGGCTGGGAGGAGGG + Intronic
1193824748 X:86209697-86209719 GTGGAAGGAGGCTTAGAGGGAGG + Intronic
1195171344 X:102271805-102271827 GTTTCAGGAGGCTCTGAGTAAGG - Intergenic
1195187516 X:102415294-102415316 GTTTCAGGAGGCTCTGAGTAAGG + Intronic
1195230579 X:102842825-102842847 GGTTAAGGAAGCTTGGGTGAGGG - Intergenic
1195251394 X:103051588-103051610 ATGTAAAGAGGCTTGGGGGAAGG + Intergenic
1196421702 X:115528973-115528995 GTTTCAGTGAGCTTGGAGGAAGG + Intergenic
1197046662 X:122005545-122005567 ATTAAAGGAGGATGGGAGGAAGG + Intergenic
1198764894 X:140070491-140070513 ATGTAAAAAGGCTTGGAGGAGGG + Intergenic
1199054789 X:143280907-143280929 TTTCAAGCAGGCTGGGAGGAAGG - Intergenic
1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG + Intronic
1201356815 Y:13105211-13105233 ATGTAAAGAGGCTTGGGGGAAGG + Intergenic