ID: 970962159

View in Genome Browser
Species Human (GRCh38)
Location 4:21884825-21884847
Sequence AGGGAAGGCAGTGACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 2, 2: 2, 3: 49, 4: 514}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970962159_970962164 2 Left 970962159 4:21884825-21884847 CCACCACAGTCACTGCCTTCCCT 0: 1
1: 2
2: 2
3: 49
4: 514
Right 970962164 4:21884850-21884872 TCCTGAAACTCTCTACCACCAGG 0: 1
1: 0
2: 0
3: 13
4: 146
970962159_970962166 12 Left 970962159 4:21884825-21884847 CCACCACAGTCACTGCCTTCCCT 0: 1
1: 2
2: 2
3: 49
4: 514
Right 970962166 4:21884860-21884882 CTCTACCACCAGGTCTTCAGTGG No data
970962159_970962168 19 Left 970962159 4:21884825-21884847 CCACCACAGTCACTGCCTTCCCT 0: 1
1: 2
2: 2
3: 49
4: 514
Right 970962168 4:21884867-21884889 ACCAGGTCTTCAGTGGCTCGTGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970962159 Original CRISPR AGGGAAGGCAGTGACTGTGG TGG (reversed) Intronic
900184210 1:1325324-1325346 AGGAAGGGCAGTGGCTGTGCAGG - Intronic
900231633 1:1561835-1561857 GGGAAAGGCATTGCCTGTGGTGG - Intronic
900757787 1:4449199-4449221 AGGGAAGTGAGTTACTGTGAAGG - Intergenic
900882180 1:5390142-5390164 AGGCAGGGCTGTGGCTGTGGGGG - Intergenic
901676914 1:10890764-10890786 AGCTAAGGGGGTGACTGTGGGGG - Intergenic
902070853 1:13735637-13735659 GGGGAAGGCAGTGCATGTGTGGG - Intronic
902161242 1:14532100-14532122 AAGGAAGGTGGTGACTGTTGTGG + Intergenic
902338497 1:15767555-15767577 GGGGCAGGCAGTACCTGTGGTGG - Exonic
902706512 1:18209009-18209031 GGTGAAGGTAGTGACTGGGGAGG + Intronic
902842008 1:19080647-19080669 AGGAAAGGTAGAGACTGTGTGGG + Intronic
902935095 1:19759284-19759306 AGCGAGGGCTGTGGCTGTGGCGG - Intronic
903024751 1:20419353-20419375 AGGGAGGTCAGTGAGTGAGGAGG + Intergenic
903121197 1:21217985-21218007 CGGGAAAGCGGTGGCTGTGGAGG + Intronic
903334082 1:22613545-22613567 TGGCAGGGCAGTGACTGTGCCGG - Intergenic
903963183 1:27070209-27070231 GGGGGAGGCAGTGAGGGTGGAGG + Intergenic
904500905 1:30912365-30912387 AGAGAAGGCTCTGACTGGGGTGG - Intergenic
905107466 1:35573173-35573195 AGGGGAGGCAGTGGCTTTGGCGG - Intergenic
905365342 1:37448256-37448278 AGGGAAGGCAGGGATGATGGTGG - Intergenic
906130833 1:43454400-43454422 AGCGAAGGCACTGACTTTGAAGG - Intergenic
907987086 1:59542865-59542887 AGGGAGGGCACTGACTTTGAGGG - Intronic
908252260 1:62274499-62274521 GGTGAAGGCAGTGTCTGTGATGG - Exonic
908282181 1:62551483-62551505 AGGGAAGACCATGACTGAGGTGG + Intronic
909130361 1:71728151-71728173 AAGGAAGGCACTGACTGAAGTGG + Intronic
909849413 1:80441652-80441674 AGGGCAGGCAGGGAGAGTGGTGG - Intergenic
910565489 1:88638352-88638374 AAAGAAGGCAGTTACTGTGCTGG - Intergenic
914917964 1:151829948-151829970 TGTGAAGGCAGGGACTGTGTTGG + Intronic
916051228 1:161038441-161038463 GGGGAAGGCACTGATTATGGGGG - Intronic
916318571 1:163478246-163478268 AGGGAAGCCAGGCAGTGTGGGGG - Intergenic
916365870 1:164027162-164027184 TAAGAAGGCAGTTACTGTGGTGG - Intergenic
916698322 1:167263704-167263726 AGGGAGGGCCTTGACTGTTGGGG - Intronic
916912821 1:169369167-169369189 AGGGAATGAAGTTACTGTGGTGG - Intronic
920379497 1:205527575-205527597 AGAGGACGCAGTGAGTGTGGGGG - Intronic
920497700 1:206467226-206467248 AGGGCAGGCAGTGGATGTGGGGG + Intergenic
920544297 1:206802721-206802743 AGGGAAGGGAGGGACAGTGTTGG - Intronic
920976155 1:210787252-210787274 AGGGACAGCAGTGGCTGTGGGGG - Intronic
921774358 1:219079996-219080018 ATGGAAGACAGTGATTTTGGTGG - Intergenic
922427966 1:225517411-225517433 AGGGAAGGCAGTGGAGGCGGCGG + Intronic
923075536 1:230605725-230605747 AGGGGAAGAAATGACTGTGGTGG - Intergenic
923232104 1:231996635-231996657 AGGGTAGGCAGTGAGTTTGTAGG - Intronic
923426657 1:233876899-233876921 AAGGAAGGAAGTTACTGTGGTGG + Intergenic
923638513 1:235725652-235725674 AGGGAAAGCAGAGTCTCTGGAGG + Intronic
924058001 1:240142834-240142856 AGGCCAGGCAGTGGATGTGGTGG - Intronic
924250903 1:242132175-242132197 AGAGAATGCAGTGATTGCGGGGG + Intronic
1062899747 10:1134071-1134093 AGGAAAGGTATTGACTGTGCAGG + Intergenic
1063422055 10:5920796-5920818 AGGTTAGGAAGTGACTTTGGTGG + Intronic
1064410550 10:15100342-15100364 ATGCAATGCAGTGACTGTGAGGG - Intronic
1065285129 10:24180223-24180245 AGGGAAGGACCTGACTGTAGAGG - Intronic
1065603316 10:27391771-27391793 TGTCAAGGCAGTGACAGTGGAGG + Intergenic
1066045108 10:31587957-31587979 AAGAAAGGCAGTGTCTGGGGTGG + Intergenic
1066206055 10:33190477-33190499 AGGCAAGGAGGTGGCTGTGGTGG + Intronic
1066400672 10:35072937-35072959 AGGGGAGGCAGAGAATGGGGAGG + Intronic
1066556328 10:36618450-36618472 AGGAGAGGCAGAGACAGTGGGGG + Intergenic
1067247893 10:44561470-44561492 AGGGAAGGCTCTGACTGAGCCGG - Intergenic
1067429529 10:46234013-46234035 AGGGGAGGCAGTGACAAAGGGGG + Intergenic
1068886744 10:62105427-62105449 AGGAAAGGCAGTGGTTGAGGTGG + Intergenic
1069308486 10:67003138-67003160 AAGGAATGAAGTCACTGTGGCGG - Intronic
1069416220 10:68203149-68203171 GGGGAAGGCAGTGGCAGGGGAGG + Intronic
1069663968 10:70142833-70142855 AGGCGAGGCTGTGAGTGTGGTGG - Exonic
1069727047 10:70586771-70586793 AGGTAGGGCAGTGTGTGTGGTGG + Intergenic
1070546851 10:77459121-77459143 AGGGAAGGCACTGACAGTAGGGG + Intronic
1070675742 10:78410217-78410239 AGGGAAGGCAGGGACTGAGATGG - Intergenic
1071712212 10:88060863-88060885 ATGGAGGGCAGTGATGGTGGTGG + Intergenic
1072097988 10:92201188-92201210 AGGGAAAGCAATGACTATGACGG + Intronic
1072187364 10:93053097-93053119 CCGCAAGGCAGTGACTGTTGGGG + Intronic
1073259484 10:102178147-102178169 AGGGAAAAGAGTGGCTGTGGGGG + Intergenic
1073586223 10:104712631-104712653 AGGGAAGGAAGAGACAGAGGAGG + Intronic
1074534153 10:114316451-114316473 AGAGCAAGCAGTGTCTGTGGAGG - Intronic
1075249016 10:120849165-120849187 AAGGAAAGAAATGACTGTGGTGG - Intergenic
1075444584 10:122504637-122504659 AGGGATGGCAGTGTCCCTGGTGG + Intronic
1075629882 10:123994553-123994575 CGGGAAAGGAGTGAATGTGGCGG - Intergenic
1076131584 10:128017526-128017548 GGGGAAGGCTGTGCCTGTGTGGG - Intronic
1076484174 10:130805141-130805163 AGGAAAGGCAGTGTCCGTGGAGG - Intergenic
1076695588 10:132245879-132245901 AGGTAAGGCAGGGCCTGGGGTGG - Exonic
1077648160 11:3944979-3945001 AGGGAAGTCAGAGAATATGGAGG - Intronic
1078179579 11:8999872-8999894 AGGGAAGGCAGTGACTGGGGTGG - Intronic
1078186719 11:9058117-9058139 AGGGAAGGCAGAGAGGGAGGGGG - Intronic
1078387310 11:10903827-10903849 AGGCAGTGCAGTGACAGTGGTGG + Intergenic
1079117891 11:17652167-17652189 AGGCTAGGCAGGGACTGTCGAGG - Intergenic
1079978930 11:27128541-27128563 GGGCAAGGCAGTGACTATGGAGG - Intergenic
1080008217 11:27431586-27431608 AGGCTAGGCAGTGTCTTTGGGGG - Intronic
1080415921 11:32070058-32070080 AGGGAAGGCAGAGTGTATGGGGG - Intronic
1080890051 11:36401378-36401400 TGGGAAGGCCGTGATTATGGGGG + Intronic
1082259893 11:50070822-50070844 AAGGAAGGCAGTGAAACTGGAGG + Intergenic
1083490478 11:63011808-63011830 TGGGGAGCCAGTGACTGTGGTGG - Intronic
1083642750 11:64154200-64154222 AGAGCAGGCAGGCACTGTGGGGG - Intronic
1083685247 11:64371484-64371506 AGGGAAGGGGGTCACAGTGGTGG - Exonic
1083726974 11:64633708-64633730 AGTGACGGCTGTGACAGTGGGGG - Intronic
1083879578 11:65541375-65541397 AGGGGAGCCAGGGAATGTGGGGG - Intronic
1084148344 11:67276687-67276709 AGGGAGAGGAGTGACTGCGGTGG - Intronic
1084603299 11:70159111-70159133 AGAGAAGCCAGTGACTCTGATGG - Intronic
1084768123 11:71325522-71325544 AGGGGAGGCAGGGACTGGAGTGG + Intergenic
1085203664 11:74717505-74717527 AGGGGAGGCAGTCATGGTGGGGG + Intronic
1085258153 11:75188800-75188822 AGGGAAGGAAGTGGCTTTGCTGG - Intronic
1085305144 11:75481650-75481672 CGGGAAGGCTGGGAATGTGGGGG - Intronic
1085321119 11:75574734-75574756 AGAGAAGGCAGAGACTGGGCTGG + Intergenic
1085496734 11:76977685-76977707 AGGGGAGGCAGTGCTGGTGGGGG + Intronic
1086381707 11:86261662-86261684 AGAGAATGCAGGAACTGTGGAGG - Intronic
1086429182 11:86718839-86718861 AGGGAAGGCATTGGCAGTGGTGG - Intergenic
1088547092 11:110970140-110970162 AGGGAAGGAATTAACTGGGGGGG - Intergenic
1089023943 11:115248311-115248333 AGGGAAGGCAGCTAATGTGATGG - Intronic
1089398620 11:118152074-118152096 AGGGAAGGCAGTGGCTCCTGAGG + Intronic
1089534748 11:119154142-119154164 AGGTAAGGAAGAGACTGGGGTGG + Exonic
1090508034 11:127340553-127340575 ATGGAAGGAAGTGGCTATGGTGG + Intergenic
1090665982 11:128915134-128915156 AAGGAAGGCATTAACTGTGTTGG - Intronic
1091304882 11:134530559-134530581 GGGGAAGACAGTGGCGGTGGGGG - Intergenic
1091352436 11:134907891-134907913 GTTGAAGGCAGGGACTGTGGAGG + Intergenic
1091450949 12:571499-571521 AGGGAGGGTAATGACTGTGCCGG - Intronic
1092017761 12:5173525-5173547 AAGGAAGCAAGTGCCTGTGGAGG + Intergenic
1092236644 12:6814750-6814772 AGAGTTGGCAGTCACTGTGGAGG - Exonic
1092526955 12:9315252-9315274 AGGGAAGGAGGTGACTGAGTAGG + Intergenic
1092540319 12:9416528-9416550 AGGGAAGGAGGTGACTGAGTAGG - Intergenic
1092968218 12:13666167-13666189 ATAGAAGGCAGTCACTGGGGAGG - Intronic
1094512730 12:31105948-31105970 AGGGAAGGAGGTGACTGAGCAGG + Intergenic
1095089158 12:38087978-38088000 AGGCAAGTCAGGGCCTGTGGTGG - Intergenic
1095224267 12:39660791-39660813 AGGGAAGGGAGGGGCTGTGAAGG - Intronic
1095583562 12:43826884-43826906 CTGGAATGCAGTGACTGTGAAGG + Intergenic
1096592424 12:52669762-52669784 AGAGAAGGCAGTTAGTGTGTGGG + Intergenic
1096664971 12:53158448-53158470 AGGGAATGCAGTGACTCTGCGGG + Exonic
1097254088 12:57659035-57659057 AGAGAAAGCATTGCCTGTGGCGG - Intergenic
1098008047 12:66020294-66020316 GGGCAAGGTAGTGACGGTGGTGG - Intergenic
1098011859 12:66061746-66061768 AGGGAAGGAAGTGTGTGGGGTGG - Intergenic
1098822562 12:75251379-75251401 AGAGAAGGTAGAGATTGTGGTGG - Intergenic
1099762936 12:86943342-86943364 AGGGAAGGAAATGACTGGGGTGG - Intergenic
1101814286 12:108134011-108134033 TGGGAAGATAGGGACTGTGGTGG + Intronic
1102168564 12:110824848-110824870 AGGGAAGGCAGGGACCCAGGAGG - Intergenic
1102360695 12:112285205-112285227 AAGGAGGGCAGGGACTGTGCTGG - Intronic
1102702633 12:114852802-114852824 AGGGAAGGTAATGACTGAGAAGG - Intergenic
1103148676 12:118617989-118618011 AGGCAAGGAAGGGACTCTGGAGG - Intergenic
1103339105 12:120211925-120211947 AGGGCAGGCAGGGTCTGTTGGGG - Exonic
1104364485 12:128164682-128164704 AGTGATGGAAGTGATTGTGGTGG - Intergenic
1104400085 12:128468138-128468160 AGGGAAGGCGTTAACTGTGCAGG + Intronic
1104580569 12:130008276-130008298 AGAGAAGGCAGTGGAGGTGGGGG - Intergenic
1105031350 12:132886563-132886585 ACTGGAGGCAGTGAATGTGGAGG + Intronic
1105701757 13:22939907-22939929 AGGGCAGGAAGAGGCTGTGGAGG - Intergenic
1105854379 13:24361695-24361717 AGGGCAGGAAGCGGCTGTGGAGG - Intergenic
1106431982 13:29689342-29689364 GGAGAAGGCAGTGTCAGTGGTGG + Intergenic
1106447590 13:29850366-29850388 AGGGAAGGCGGAGACCGGGGAGG - Exonic
1106800371 13:33250241-33250263 AGGAAAGTCAGTTACTTTGGGGG + Intronic
1109180011 13:59202449-59202471 GGGGAAGGGAGTGAGAGTGGAGG - Intergenic
1110854638 13:80283013-80283035 AGTGAAGACAGGGATTGTGGTGG - Intergenic
1113447920 13:110384739-110384761 AGGGAAGACAGTGGCTTTGGAGG - Intronic
1113859728 13:113473317-113473339 AGGGACTGCAGTGAAGGTGGAGG - Intronic
1114452923 14:22838291-22838313 AGGTAAGGCAGTGAAGTTGGCGG - Intronic
1114613947 14:24058637-24058659 AGGGAAGGCAGGGGTTGGGGTGG - Intronic
1115315914 14:32024797-32024819 AGGGAAATTAGTGACAGTGGAGG - Intergenic
1115960941 14:38835935-38835957 AGGCCATGCAGCGACTGTGGTGG - Intergenic
1117187135 14:53251617-53251639 AGGGTAGGCAGGGAATGGGGAGG - Intergenic
1117387596 14:55231735-55231757 AGTGATGGCAGTCATTGTGGTGG + Intergenic
1118112926 14:62742959-62742981 AGGGAAGGCAGTTGCTTTTGGGG - Intronic
1119046135 14:71320572-71320594 AGGGAATGGAGTGGCTGCGGGGG - Intronic
1119163372 14:72471667-72471689 GAGAAAGGCAGAGACTGTGGGGG - Intronic
1119508081 14:75190138-75190160 ATTGAAAGCAGTGACAGTGGGGG - Intergenic
1121588309 14:95079085-95079107 AGGGAAGGGAGTGTCTCAGGCGG + Intergenic
1121598661 14:95186246-95186268 AGGGAAGGCAGAGGCACTGGGGG - Exonic
1121699979 14:95945294-95945316 AAGGCAGGAAGTGTCTGTGGTGG - Intergenic
1121780295 14:96617840-96617862 AGGGGATGCAGTGACTGAAGAGG + Intergenic
1122232709 14:100314833-100314855 AGGGAAGGCAGTGAGCCCGGTGG - Intergenic
1122251248 14:100441391-100441413 AGGGAAGGCAGTGCAGGGGGTGG + Intronic
1122316956 14:100831391-100831413 AGGAAAGACAGAGACTGTAGTGG - Intergenic
1122592928 14:102868379-102868401 AAGGAAGGGAGTGGCTGTGAAGG - Intronic
1123990606 15:25680544-25680566 AGGGAAAGGAGAGAATGTGGTGG + Intronic
1124126972 15:26945156-26945178 TGGGAAGGCAGTGGCGCTGGGGG + Intronic
1124480609 15:30075924-30075946 GGGGAAGGCTGTGAATGTGTAGG - Intergenic
1124853112 15:33360254-33360276 TGGGCAGGGACTGACTGTGGAGG - Intronic
1125239587 15:37558493-37558515 AGGGAGGGCACTGGCAGTGGTGG - Intergenic
1125903386 15:43369634-43369656 AGAGGAGGCAGTGACTCTCGTGG - Exonic
1127837099 15:62798696-62798718 AGGGGATGCAGTGACTGTGCTGG + Intronic
1128594454 15:68930889-68930911 AGGGAACGCAGCAACTGAGGCGG + Intronic
1129269720 15:74413176-74413198 TGTGAAGGCAGTGGCTGGGGTGG - Intronic
1129388094 15:75206883-75206905 GGGCAAGGCAGGGCCTGTGGAGG - Exonic
1129467894 15:75734105-75734127 AGGGGAGGCATGGACTGTGAGGG + Intergenic
1129618469 15:77120406-77120428 TGGGAAAGCAGTGAGTTTGGTGG - Intronic
1129741302 15:77990948-77990970 GGGGATGACAGTGGCTGTGGGGG - Intronic
1129844362 15:78761451-78761473 GGGGATGACAGTGGCTGTGGGGG + Intronic
1130668658 15:85891066-85891088 TGGGAAGGGATGGACTGTGGGGG - Intergenic
1131488765 15:92843961-92843983 AGGGAAGGCATAGAGTGTGCTGG - Intergenic
1131587132 15:93707726-93707748 AGGGAATGGAGAGACTGTGCTGG - Intergenic
1132021724 15:98368337-98368359 CGGGAAGGAAGTGACTGAGTGGG - Intergenic
1132410713 15:101576414-101576436 AGGGGAGGCTGTGCCTGTAGTGG + Intergenic
1133022767 16:2974144-2974166 AGGGCAAGCAGGGCCTGTGGGGG + Exonic
1133056304 16:3147194-3147216 AGGGCAGCCAGTGGCTGGGGAGG + Intronic
1133819951 16:9227240-9227262 AGGGATGGGAGTCAGTGTGGAGG - Intergenic
1134424032 16:14122089-14122111 GGGGAAGGCAGGGAGAGTGGAGG - Intronic
1135176702 16:20236254-20236276 AGCGAAGGCACTGTGTGTGGTGG - Intergenic
1135546102 16:23367800-23367822 GGGGGAGGCATTGCCTGTGGTGG + Intronic
1136081680 16:27856234-27856256 GGGGAGGGCAGGGACAGTGGGGG + Intronic
1136611684 16:31370370-31370392 AGGGGAGGCAGTGCCTGGGAGGG + Intronic
1139626531 16:68193886-68193908 AGGGAAGGATATGTCTGTGGTGG + Intronic
1141556870 16:84842217-84842239 AGGGAACGCAGTGACTCTGAGGG - Intronic
1141594797 16:85090754-85090776 AGAGCAGGCAGTGGCTCTGGAGG + Exonic
1141627202 16:85267444-85267466 AAGGAGGGCAGTGACCGTGGGGG + Intergenic
1141674251 16:85509287-85509309 TGGGAAGGCAGTGTTGGTGGGGG + Intergenic
1141903652 16:87008638-87008660 TGGGCCGGCAGTGACTTTGGTGG + Intergenic
1142173625 16:88635094-88635116 AGGGCAGCCAGTGCCTGAGGAGG - Intergenic
1142708239 17:1709771-1709793 AGGGAAGGCTGGGCCGGTGGTGG - Intronic
1142858805 17:2749064-2749086 AGGGAAGGCAGGGGTTGGGGGGG + Intergenic
1142872131 17:2827871-2827893 AGGCACGCCAGTGACGGTGGGGG + Intronic
1142969378 17:3601059-3601081 CGGGAGGGGAGTGAATGTGGAGG - Intergenic
1143021015 17:3917268-3917290 AGGGAAGGCAGGGACTGCAGAGG - Intergenic
1143200395 17:5109429-5109451 AGAGGAGGCTGTGACTGTGCTGG - Exonic
1143482344 17:7234822-7234844 AGTGAAGGTGGGGACTGTGGGGG + Intergenic
1143760840 17:9102961-9102983 ATGGAGGGTAGTGACTGTGGAGG + Intronic
1143954705 17:10659034-10659056 AGGGCAGGCTGTGGGTGTGGCGG + Intergenic
1144165250 17:12604282-12604304 AGGGAGGGGAGTGAGCGTGGTGG + Intergenic
1144245284 17:13356771-13356793 AGGGGAGGCTGTGCATGTGGGGG - Intergenic
1144735315 17:17552447-17552469 AGGGATGGGAGGGACGGTGGTGG - Intronic
1145229781 17:21165218-21165240 GGACAAGGCACTGACTGTGGTGG - Intronic
1146635360 17:34500130-34500152 AGGGAAGCCAGTGTTTCTGGAGG - Intergenic
1146646223 17:34579146-34579168 AGGGACATCAGTGACTGCGGTGG + Exonic
1146772071 17:35578297-35578319 AGGGCAGAGCGTGACTGTGGGGG + Exonic
1147357555 17:39909724-39909746 CTGGGAGGCAGGGACTGTGGAGG - Intronic
1147661235 17:42118148-42118170 AGAGAAGGCAGGGACTGGGGGGG + Intronic
1148637208 17:49157999-49158021 AGAGAAGAGAGTGGCTGTGGGGG + Intronic
1148839510 17:50485790-50485812 GGGGAAGGAAGTGAGTGAGGGGG - Exonic
1149495096 17:57112580-57112602 AGAGAAGGCAGTGCCAGTGAAGG - Exonic
1150448939 17:65249529-65249551 AGGTAAGCCAATGACTATGGAGG - Intergenic
1151337909 17:73450947-73450969 AGGGAAGCCTGAGACTGAGGTGG - Intronic
1151707055 17:75774668-75774690 AGGGAAGGAAGAGGCTGTGAGGG + Intergenic
1152053262 17:77999371-77999393 AGGGAAGGCAATCTGTGTGGGGG - Intergenic
1152372852 17:79901292-79901314 AAGGGAGGCAGTGCCTGGGGAGG + Intergenic
1152599385 17:81254032-81254054 GGTGATGGCAGTGACGGTGGAGG - Intronic
1152648688 17:81482069-81482091 TGGCCAGGCTGTGACTGTGGGGG - Intergenic
1153092512 18:1364183-1364205 AGGGTAGTCAGGGAGTGTGGGGG - Intergenic
1153543146 18:6178831-6178853 AGGAAAAGCAGAGACTGTGTTGG - Intronic
1153914604 18:9734385-9734407 AGGAAAGGCAGCGGGTGTGGTGG - Intronic
1154489577 18:14909299-14909321 GGGGAAGGCAGTGACAATGAGGG + Intergenic
1156249635 18:35340269-35340291 AGAGGAGGCAGTGACAGTGCTGG - Exonic
1156269377 18:35517022-35517044 TGGGCAGACAGTGACGGTGGAGG - Intergenic
1156377928 18:36531415-36531437 AGGAATGGCTGTGACTGTGAGGG - Intronic
1157190938 18:45581049-45581071 GGGGAAGGGAGGGAATGTGGAGG + Intronic
1157280694 18:46344741-46344763 AGGTGAGGGAGTGACAGTGGGGG + Intronic
1157286939 18:46383204-46383226 AGGGGAGGCAGTGGGTGTTGGGG + Intronic
1157394567 18:47331008-47331030 AGGGAAAGCAGTGATGGTGGGGG - Intergenic
1157400165 18:47380745-47380767 TGGGATGGCAGTGAGTGAGGAGG - Intergenic
1157562177 18:48656120-48656142 TGGGAAGGCAGTGCTGGTGGAGG - Intronic
1157594248 18:48854238-48854260 AGGGAGGGCAGGGACTGGGGTGG + Intronic
1158453942 18:57590541-57590563 AAGACAGGCTGTGACTGTGGAGG - Intergenic
1160503127 18:79411967-79411989 AGGGAAGGCAATTACTGCAGGGG - Intronic
1160826903 19:1084534-1084556 AGGCAAGGCAGTGCCTTTTGAGG + Intronic
1160840907 19:1146706-1146728 GGGGAAGGCTGTGAGGGTGGGGG + Intronic
1160913828 19:1487541-1487563 AGGGAAGGGGGTGACTCTGGCGG - Intronic
1162173785 19:8813982-8814004 AGTGATGACAGTGACAGTGGTGG + Intronic
1163202379 19:15778308-15778330 AGGGGAGTCAGTGAGTGAGGAGG + Intergenic
1163202383 19:15778328-15778350 AGGGGAGTCAGTGAGTGAGGAGG + Intergenic
1163202408 19:15778432-15778454 AGGGGAGGGAGTGAGTGAGGAGG + Intergenic
1163202414 19:15778452-15778474 AGGGGAGGGAGTGAGTGAGGAGG + Intergenic
1163202420 19:15778472-15778494 AGGGGAGGGAGTGAGTGAGGAGG + Intergenic
1163202426 19:15778492-15778514 AGGGGAGGGAGTGAGTGAGGAGG + Intergenic
1163202444 19:15778568-15778590 AGGGGAGGGAGTGAGTGAGGAGG + Intergenic
1163211586 19:15844943-15844965 AGAGATGGCAGTGGCTATGGGGG + Intergenic
1164229666 19:23276196-23276218 AGGCAAGTCAGAGTCTGTGGTGG - Intergenic
1164245147 19:23421938-23421960 AGGCAAGTCAGAGTCTGTGGTGG - Intergenic
1164454863 19:28398567-28398589 AGGAAAAGCAGGGACTCTGGAGG - Intergenic
1164576259 19:29407116-29407138 AGAGAAGGCAGAGAGTGTGAGGG - Intergenic
1164677961 19:30114959-30114981 AGCCAAGGCAGTGAAAGTGGAGG - Intergenic
1164680502 19:30131056-30131078 AGGGAAGGGAGTGAGGGGGGAGG - Intergenic
1164680528 19:30131129-30131151 AGGGAAGGGAGTGAGGGGGGAGG - Intergenic
1165384160 19:35500691-35500713 AGAGAAGGCAGTGAGCCTGGAGG + Intronic
1165948534 19:39459432-39459454 GGGGAAGTCAGTGAGTGTGAGGG + Intronic
1166349007 19:42185466-42185488 AGGGGAGCCAGTTACTGTGAAGG - Intronic
1167643189 19:50693225-50693247 AGGGAATTCAGGGAATGTGGGGG - Intronic
1167686999 19:50962685-50962707 TGGGAAGGCAGAGACAATGGGGG - Intronic
1167843235 19:52139314-52139336 AGGAAAAGCAGTGGCTGTGAAGG + Intronic
1167903234 19:52637795-52637817 AGGGGAAGAGGTGACTGTGGAGG + Intronic
1167913913 19:52725207-52725229 AGGGGAAGCGGTGACTGCGGAGG + Intronic
1167925922 19:52821066-52821088 AGGGGAAGCGGTGACTGCGGAGG + Intronic
1167930108 19:52857052-52857074 AGGGGACGCGGTGACTGCGGAGG + Intronic
1167937928 19:52922850-52922872 AGGGAAAGCGGTGACTGCGGAGG + Intergenic
1167987936 19:53334196-53334218 AGGGTAAGCGGTGACTGCGGTGG - Intronic
1167995135 19:53395690-53395712 AGGGAAAGCAGTGACTGTGGAGG - Intronic
1167999392 19:53432505-53432527 AGGGGAAGCGGTGATTGTGGAGG - Intronic
1168003643 19:53468275-53468297 AGGGGAAGCCGTGACTGCGGAGG - Intronic
1168317145 19:55489320-55489342 AGGAATGGCTGTGACTGGGGAGG - Intronic
1168414939 19:56161711-56161733 GAGCAAGGCAGTGACCGTGGGGG - Intergenic
1168421320 19:56205977-56205999 GGGGATGGCATGGACTGTGGTGG - Exonic
1168426574 19:56244106-56244128 GGGGAAGCCACAGACTGTGGCGG - Intronic
925746626 2:7049093-7049115 AGGGAAGGCAGGGCCTGGGGAGG + Intronic
925794628 2:7528727-7528749 TGAGAAGGCAGTGACCATGGAGG - Intergenic
927337063 2:21937364-21937386 AGGCAAGGCAATGTCTCTGGAGG + Intergenic
927765037 2:25799024-25799046 GGGGAAGGCTGTGCATGTGGCGG + Intronic
928696088 2:33851655-33851677 AAGAAAGACAGAGACTGTGGAGG + Intergenic
929769758 2:44881657-44881679 AGGAAAGGCAGGGAGTGGGGGGG + Intergenic
930747139 2:54896379-54896401 AGGGAAGACAGGGACTAAGGAGG - Intronic
930799907 2:55433263-55433285 AGGGGAGGAGGTAACTGTGGTGG - Intergenic
930955406 2:57197279-57197301 AAGGAAAGAAATGACTGTGGTGG - Intergenic
931669031 2:64630391-64630413 AGTGAAGGCAGAGACTGGGGCGG - Intergenic
932226743 2:70047375-70047397 AGGGGAGACAGCCACTGTGGTGG + Intergenic
932846634 2:75142119-75142141 AGGGGAGGCAGTGAGTGGAGAGG + Intronic
933702300 2:85264032-85264054 AGTGGAGGCATTGACAGTGGGGG + Intronic
933728987 2:85443149-85443171 TGGGAAGACAGTGAGTGTGCTGG - Intergenic
934953129 2:98592914-98592936 AGGGGAGGGAGTGCCTGTGCAGG - Intronic
935171300 2:100612994-100613016 AAGGCAGGCAGTGGGTGTGGGGG + Intergenic
935253063 2:101282585-101282607 AAGGAAGACAGTGAAAGTGGAGG + Intronic
937782773 2:125858445-125858467 AGGGGAGGCAGTGGCTGTGGTGG - Intergenic
937892304 2:126948125-126948147 AGGAAAGGCAGTGATTCTAGAGG - Intergenic
938115898 2:128602789-128602811 TGGGGAGGCAGTACCTGTGGAGG - Intergenic
938672526 2:133599678-133599700 AGGGCAGGCAGTGGCAGTTGTGG + Intergenic
938710379 2:133971419-133971441 TGGGAAGGCACTCAGTGTGGGGG + Intergenic
938902501 2:135809734-135809756 AGTGAAGGCTCTGACTTTGGAGG + Exonic
941655738 2:168143273-168143295 AATGAAGGCAGTGGCTGTGGAGG - Intronic
942144803 2:173016440-173016462 AAGGAAGGGCTTGACTGTGGGGG + Intronic
943276595 2:185875924-185875946 AAGGATAGCAGAGACTGTGGTGG - Intergenic
944689563 2:202147365-202147387 AGGGGAGGCAGGGAATTTGGGGG + Intronic
946408326 2:219504413-219504435 TGGGCAGGCAGTGACAGAGGAGG - Intronic
946514157 2:220393302-220393324 AGTGGAGGCAGAGACTGGGGAGG + Intergenic
947540955 2:230977739-230977761 ATGGAAGGCATTCACCGTGGAGG + Intergenic
947638676 2:231693879-231693901 AGGGAAGGCCCTGACCCTGGGGG - Intergenic
947745008 2:232502963-232502985 AGGGAAGGCAGAGGCGGGGGCGG + Intergenic
947956334 2:234195330-234195352 GGGGAAGGCAGGGTCTGGGGAGG - Intergenic
948068558 2:235101226-235101248 AGGGAAGGAAGGGAGTGAGGAGG + Intergenic
948749300 2:240121620-240121642 AGTGAAGGAACAGACTGTGGTGG - Intergenic
948749949 2:240126034-240126056 ATGGAACGCAGTGACTCGGGAGG + Intergenic
948995978 2:241579015-241579037 AAGCAGGGCAGTGACTGTCGGGG + Intergenic
1169306422 20:4494900-4494922 GGGGAAGGGAGAGGCTGTGGAGG - Intergenic
1169841505 20:9943209-9943231 AGGGTAGGCAGTGGCTGCGAGGG - Intergenic
1170304033 20:14917888-14917910 AGGGAAGAGAGTAACTGTGTAGG + Intronic
1171968731 20:31550013-31550035 AGGGAAGTGAGGGGCTGTGGGGG - Intronic
1172077560 20:32310927-32310949 AGGGAAGGTGGTGGCAGTGGTGG + Exonic
1172115802 20:32572807-32572829 AGGGAAGCCAGAGCCTGTGCAGG - Intronic
1172155908 20:32824378-32824400 AGGGAGGGAAGAGAATGTGGAGG + Intronic
1172445830 20:34993016-34993038 GGGGAAGTCAGGGACTGAGGAGG - Intronic
1173033446 20:39383929-39383951 AGAGAAGATCGTGACTGTGGAGG + Intergenic
1173671125 20:44799586-44799608 AGTGAGTGCAGTGAGTGTGGTGG + Intronic
1173907515 20:46639677-46639699 AGGGAAGGGAGCGATTGTGCTGG - Intronic
1174267701 20:49343982-49344004 TAGGAAGGCAGAGGCTGTGGTGG + Intergenic
1174561894 20:51436911-51436933 AGGGAAGCCAGTGACTTCAGTGG + Intronic
1175240047 20:57540504-57540526 AGGGAAGGCTGAGGCTGGGGAGG - Intergenic
1175892420 20:62321561-62321583 AGTGGAGGCAGGGCCTGTGGAGG + Intronic
1175989248 20:62779312-62779334 AGGGAAGGTGGGGGCTGTGGGGG - Intergenic
1176156270 20:63622916-63622938 TGGGAGAGCAGTGAGTGTGGCGG + Intronic
1176857420 21:13984095-13984117 AGAGTTGGCAGTGACAGTGGTGG + Intergenic
1176867186 21:14060127-14060149 AGAGTTGGCAGTGACAGTGGTGG - Intergenic
1179288229 21:39996349-39996371 AAGAAAGGCAGGGATTGTGGTGG + Intergenic
1179802717 21:43818830-43818852 AGACAAGGCAGTGAATGTTGGGG - Intergenic
1180062147 21:45390958-45390980 TGGGAAGGCAGTGGTCGTGGGGG - Intergenic
1180700006 22:17776098-17776120 AGGAGAGGCAGAGACTGTGGGGG - Intergenic
1180715914 22:17872200-17872222 CGTGGAGGCAGTGACTGTGGCGG - Intronic
1181964688 22:26648086-26648108 AGGGAAGGCAGCCGCTGTGCTGG + Intergenic
1182023708 22:27101239-27101261 AGGGAAGGCTGAGACCTTGGGGG + Intergenic
1182267203 22:29126452-29126474 AGAGAAGGCAGAGACTGGAGTGG - Intronic
1182452815 22:30431246-30431268 AGGTATGGCAGGGACTGGGGAGG - Intergenic
1182743566 22:32587338-32587360 AGGGAGGGCAGTGGGTGTTGGGG + Intronic
1182925889 22:34124436-34124458 AGGGAAGGGTGGGACTGTGAAGG - Intergenic
1183467399 22:37986624-37986646 GAGGAAGGCAGTGTCTGTGCGGG - Intronic
1183654212 22:39175648-39175670 AGGGGAGGCCGTCACTCTGGAGG - Intergenic
1183780556 22:39996040-39996062 AGGAGAGGCTGTGACTGTGAGGG - Intronic
1183865077 22:40697972-40697994 GAGGAAGGCAGAGACTGTGAGGG + Intergenic
1184213653 22:43052010-43052032 AGGGAAGGAAGCGTTTGTGGTGG - Intronic
1184220101 22:43094520-43094542 TGGGAAGTCAGGGCCTGTGGTGG - Intergenic
1184376589 22:44117351-44117373 CAGGAAGCCAGTGAGTGTGGGGG + Intronic
1184534577 22:45077786-45077808 AGAGAAGGCAGAGAGTGTGCAGG + Intergenic
1184660796 22:45964664-45964686 AGGGGTGGCAGAGCCTGTGGTGG - Intronic
1184886994 22:47352467-47352489 AGGGAAGGGAGTGACTGGAGGGG - Intergenic
1185200729 22:49502846-49502868 AGGCAAAGGAGTGACTGTGGAGG + Intronic
1185352751 22:50346510-50346532 AAGGAGGGCACTGACTGGGGGGG - Intronic
950718487 3:14866115-14866137 AGAGAACTCAGTGACCGTGGTGG - Intronic
953138433 3:40204690-40204712 AGTGAAGGCAGAGAAAGTGGAGG - Intronic
953177508 3:40565301-40565323 AAGGAAAGAAGTGACTGCGGTGG - Intronic
953216726 3:40925176-40925198 AGGGAAGGCATGGACTTTGCTGG + Intergenic
953692777 3:45133904-45133926 AGTAAAGGCAGTGACGGAGGTGG - Intronic
953884981 3:46710010-46710032 AGGGATGGCAGTGGCTGTGAAGG + Exonic
954317175 3:49807446-49807468 AAGGAAGGAGGGGACTGTGGGGG + Intronic
955520606 3:59772073-59772095 ATACAAGCCAGTGACTGTGGAGG - Intronic
955801492 3:62691402-62691424 AGGGGAGGCTGTGTCTGTGTAGG + Intronic
956604670 3:71062094-71062116 ATGCAAGGCAGTGACGGTGAGGG + Intronic
956743183 3:72290912-72290934 AGGGCACTGAGTGACTGTGGAGG - Intergenic
956787037 3:72651483-72651505 GGTGAAGGCATTGACGGTGGTGG - Intergenic
956787080 3:72651738-72651760 GTTGAAGGCATTGACTGTGGTGG - Intergenic
957160878 3:76608314-76608336 AGAGAAGAAAGGGACTGTGGAGG + Intronic
957740744 3:84265038-84265060 AAGGAAGGGAGTGAGTGGGGAGG - Intergenic
959077950 3:101770869-101770891 AGTGAAGGTAGTGAGTGTTGGGG + Intergenic
959818514 3:110704146-110704168 AGTGAAGGCTGTGTGTGTGGGGG + Intergenic
960519297 3:118636861-118636883 AGGGAAGGCAGTGGGTCTGGCGG - Intergenic
961037551 3:123653074-123653096 AGGAGTGGCAGTGGCTGTGGTGG + Intronic
961106029 3:124242467-124242489 AGTGAAGGAAGTGGCAGTGGTGG + Intronic
961551224 3:127671687-127671709 AGGGGAGGCAGTGACTCTCCTGG + Intronic
961557109 3:127703259-127703281 TGAGAAGGCAGAGAATGTGGTGG - Intronic
961594755 3:128007204-128007226 CTGGAAGGCAGTCACTGTGTGGG - Intergenic
961684694 3:128621574-128621596 AGGGGAGTCAGTGACTCTGAGGG + Intronic
962011906 3:131399946-131399968 TGGGAAGAGAGTGACTTTGGGGG + Intergenic
962794672 3:138839869-138839891 TGGGAGGGCAGTGACATTGGAGG + Intergenic
962863388 3:139425391-139425413 AGGGATGGAAGTGGCTGTGAGGG + Intergenic
963771939 3:149395908-149395930 AGGGCAGCCAGTGGATGTGGTGG + Intergenic
963867022 3:150372670-150372692 TGGGAAGGATGGGACTGTGGGGG - Intergenic
967010538 3:185428945-185428967 AGGTCAGGCAGTGGCAGTGGTGG + Exonic
967911104 3:194543190-194543212 AGGTAAGGTTGTGCCTGTGGTGG - Intergenic
968059258 3:195714514-195714536 TGGGAAGCCAGTGCCAGTGGTGG - Intergenic
968287910 3:197518949-197518971 AGAGCAGGAAGTGACTGAGGGGG - Intronic
968531287 4:1093120-1093142 AGGGCAGGCAGTGGCTGAGGTGG + Intronic
968591971 4:1463941-1463963 AGGGAGGGCAGGGGCTGGGGAGG - Intergenic
968816678 4:2825045-2825067 AGGCAGGGCAGTGAAGGTGGAGG + Intronic
968936307 4:3612255-3612277 GGAGGAGGCAGTGACTGTGGGGG + Intergenic
969475802 4:7421896-7421918 AGGGAGGGCAGGGGCTGGGGCGG + Intronic
969620484 4:8276457-8276479 CTGGAAGGCGGTGTCTGTGGAGG + Intronic
969625960 4:8305914-8305936 TGGGAAGGCTGTGCCTGGGGAGG + Intronic
970941807 4:21642760-21642782 AGGGAAGGAAGTTACAGTGCTGG + Intronic
970962159 4:21884825-21884847 AGGGAAGGCAGTGACTGTGGTGG - Intronic
971400290 4:26269778-26269800 AGGGAAGGGAGTGAAGGGGGAGG + Intronic
972463457 4:39328862-39328884 ACGGAAGGCTTGGACTGTGGTGG + Intronic
972615838 4:40697154-40697176 AGGGGAGGCTGTGCATGTGGCGG + Intergenic
974293909 4:59969612-59969634 AGCAAAGGCATTCACTGTGGAGG - Intergenic
974543787 4:63274817-63274839 AGGGAAGGCATTGAGAATGGAGG + Intergenic
976595433 4:86891406-86891428 AGGGTAAGCATTGACTGCGGTGG - Intronic
977887032 4:102263957-102263979 AGGGAAGGAAGTAACTGCAGAGG - Intronic
978166462 4:105614348-105614370 GGGGAAGGCAGTGGCATTGGAGG - Intronic
978398856 4:108310472-108310494 TTGAAAGGCAGTGAATGTGGAGG - Intergenic
979271200 4:118764248-118764270 ATGAGAGGCAGTGAGTGTGGGGG + Intronic
982095461 4:151918121-151918143 GGGCAAGGAAGTGACTGTGTTGG + Intergenic
984011812 4:174380824-174380846 AGGGAACTCAGAGACTGTGCCGG + Intergenic
986189806 5:5485012-5485034 AGGGAAGGCTGCGAGTGTAGGGG + Intronic
988487353 5:31677908-31677930 AGGGAAGGGAGGGACTTTGGGGG + Intronic
990332061 5:54738135-54738157 AGGGAAAGCAGACACTGAGGAGG - Intergenic
991977329 5:72196184-72196206 AGAGAAGGCAGAAACTGAGGAGG + Exonic
992696315 5:79291765-79291787 AGGATAGACAGTGACTGTAGCGG - Intronic
992750857 5:79859289-79859311 AGGGGAGGCAGGGATTTTGGTGG + Intergenic
995061430 5:107815113-107815135 AAGGAAGGCAGAGAAAGTGGTGG + Intergenic
995613401 5:113934960-113934982 AGGGAAGATAGTCAATGTGGGGG + Intergenic
997187827 5:131900284-131900306 AGGGAAGGCATTGAGAGTGAAGG + Intronic
997564309 5:134875191-134875213 AGGGAAGGCAGCCACTCTAGAGG + Intronic
997899548 5:137753044-137753066 AGGGAAGGCGGTGTGTGTGAGGG + Exonic
999077470 5:148810288-148810310 AGGGAAGGCTGTGTGTGTGTGGG - Intergenic
999383670 5:151139499-151139521 AGGGAAGGAAGTGGCCCTGGTGG - Intronic
999885796 5:155921257-155921279 AGGGACAGCAGTTTCTGTGGAGG + Intronic
1000092755 5:157944487-157944509 AGAGAAGGCAGACACAGTGGAGG + Intergenic
1001073592 5:168607326-168607348 TGGGATGGGAGTGACTGTGGAGG - Intergenic
1001269892 5:170303083-170303105 AGGGAGTTCAGTGACTGTCGAGG - Intergenic
1001690732 5:173630832-173630854 AGTGCAGGCAGTCACTGTGAGGG - Intergenic
1002106389 5:176881333-176881355 AGAGCTGGCAGTGTCTGTGGGGG - Exonic
1002595294 5:180318154-180318176 AGCGAATGCAGGGGCTGTGGCGG + Intronic
1003429865 6:6029178-6029200 AGGGGAAGAAATGACTGTGGTGG + Intergenic
1004084739 6:12435109-12435131 ATGAAAGGCAGTTATTGTGGCGG - Intergenic
1004283209 6:14298340-14298362 AAGGGAGGAAATGACTGTGGTGG + Intergenic
1004507686 6:16260375-16260397 AAGGGAGGAAATGACTGTGGTGG + Intronic
1005582193 6:27245986-27246008 AGGCAAGGGAGTGAGTGGGGAGG - Intergenic
1005689055 6:28284149-28284171 AGAGGAGGCAGTGACAGTGCTGG + Exonic
1005704261 6:28435897-28435919 AGAGGAGGCAGTGACTGTGCTGG - Exonic
1005842351 6:29752135-29752157 AGGGAGGGTAGACACTGTGGAGG - Intergenic
1006093880 6:31644113-31644135 TGGGAAGGCCGAGCCTGTGGAGG + Exonic
1006110513 6:31741873-31741895 AGGGAAGGCAGGGTGTGTAGAGG + Intronic
1006134064 6:31885024-31885046 TGGGAAGGGAGTGAGGGTGGGGG + Intronic
1006320066 6:33314904-33314926 AAGGAAGACAGTAAGTGTGGTGG + Exonic
1006362514 6:33594741-33594763 AGCAAAGGCAGTGAGAGTGGGGG - Intergenic
1006413501 6:33889863-33889885 AGGGTAGGCAGAGACTAGGGTGG - Intergenic
1006520671 6:34569175-34569197 AGGGAGGACAGAGACTGCGGGGG + Intergenic
1007173738 6:39882580-39882602 AGGGAAGGCAGGGACGGCGCTGG - Intronic
1007445282 6:41900694-41900716 AGGCAAGGCTGTGAATGTGAAGG - Intergenic
1007692459 6:43711508-43711530 TGGGAAGGGAGTCACTGGGGTGG + Intergenic
1007836285 6:44676510-44676532 AGGGGAAGCAGTGACTGGGTTGG + Intergenic
1007848377 6:44780086-44780108 AGGGGAGGAAGAGACTGTGGAGG + Intergenic
1008201647 6:48598401-48598423 AGAAAAGGCAGAGAGTGTGGTGG - Intergenic
1008514735 6:52308289-52308311 AGAGAAGGAAGGGACTCTGGAGG - Intergenic
1008715508 6:54284519-54284541 AGGAGGGGCAGTGACTGTGACGG - Intergenic
1010344679 6:74798173-74798195 AGGGGAGCCAGTGACTGAGATGG + Intergenic
1012173365 6:96047643-96047665 AGGGAAGGCAGGGAGGATGGAGG - Intronic
1012921430 6:105224291-105224313 AGGGCAGACAGTGATGGTGGTGG + Intergenic
1013393900 6:109714328-109714350 AGGGAAGGCACTGAGAGTGGTGG - Intronic
1013581643 6:111540877-111540899 TGGAAAGGCAGTTACTTTGGGGG + Intergenic
1013626297 6:111940654-111940676 AGGGTAGACAGTGAATCTGGAGG - Intergenic
1013654225 6:112228649-112228671 AGGGAAAGCTGGAACTGTGGAGG + Intronic
1014623401 6:123697208-123697230 AGGTAAGGCAGGGAAAGTGGAGG - Intergenic
1015577641 6:134690035-134690057 TGGGAAGGAAGGGACTGTGGAGG - Intergenic
1016107474 6:140180263-140180285 AATGAAGGCAGTGAATCTGGAGG + Intergenic
1016818657 6:148326898-148326920 AGGGCAGGATGTGACGGTGGAGG - Intronic
1016905679 6:149148360-149148382 AGGGCAGGCAGGGACTGGGAAGG + Intergenic
1017014274 6:150087581-150087603 AGGGAAGGACAGGACTGTGGAGG - Intergenic
1017295749 6:152791660-152791682 AGGGAAGGCAGTTACTCATGTGG - Intergenic
1017431807 6:154378757-154378779 AGGGAATGCAGTGACAGGGATGG + Intronic
1017796519 6:157849780-157849802 AGAGAAGGCAGGGTCTGTGCTGG + Intronic
1017817894 6:158028320-158028342 AGTCAAGGCAGTGGCTGAGGAGG + Intronic
1017823730 6:158066635-158066657 GGTGAGGGCAGTGACTTTGGGGG + Exonic
1017872867 6:158501974-158501996 GGGGGAGGCAGGGACAGTGGAGG - Exonic
1018850939 6:167589653-167589675 GGGAAAGGCAGGGTCTGTGGGGG - Intergenic
1019330342 7:457786-457808 AGGGGTGGCAGTGAGGGTGGGGG + Intergenic
1019755212 7:2763753-2763775 AGGAAAAGCAGAGCCTGTGGGGG - Intronic
1019810996 7:3165055-3165077 AAGGCAGGGACTGACTGTGGGGG + Intronic
1021725637 7:23545562-23545584 AGGTGAGGAAGTGACTGTGGTGG - Intergenic
1022190087 7:28009098-28009120 ATGGAAGGCAGAGACTCTGATGG + Intronic
1022332826 7:29396720-29396742 TGGGTTGGCAGTGAGTGTGGGGG - Intronic
1023551584 7:41375714-41375736 TGGGAAGGCTATGCCTGTGGGGG - Intergenic
1023577785 7:41648008-41648030 AGGGAAGGCTGTGTATGTGTGGG - Intergenic
1024243988 7:47455691-47455713 AGAGAAGGCAGTGCCAGAGGTGG + Intronic
1024939354 7:54746075-54746097 AGGCAAGGCAGTGAGACTGGAGG - Intergenic
1025794266 7:64723411-64723433 AGGGAAGGCAGTGCCCGTGAGGG + Intergenic
1026628607 7:72018347-72018369 AGGGAAGGAAGGGACTGAGCGGG - Intronic
1026630531 7:72033897-72033919 AGGGAAGGCAGCCAGTGTGGAGG + Intronic
1029125201 7:98290784-98290806 AGGCAAGGCAGGGTGTGTGGTGG - Intronic
1029175993 7:98664794-98664816 AGGGAAGGTAGAGACTGGTGGGG + Intergenic
1030807792 7:113937712-113937734 AGGGAAGGCACTGAGAGTGCAGG - Intronic
1031004975 7:116459845-116459867 AGGGGAAGAAATGACTGTGGTGG - Intronic
1031723545 7:125207640-125207662 ATGGTAGTGAGTGACTGTGGTGG + Intergenic
1032277871 7:130475490-130475512 AGGCAAGGCAATGATTGAGGGGG - Intergenic
1033044354 7:137947860-137947882 GGGGAAGGAAGTGGATGTGGAGG - Intronic
1033228017 7:139576082-139576104 AGAGGAGACAGTGTCTGTGGTGG + Intronic
1036127984 8:6081348-6081370 AGAGAAGCCAGTTACTATGGAGG + Intergenic
1036159085 8:6369783-6369805 AGGTAAGGGAGTGATGGTGGAGG + Intergenic
1037805815 8:22057430-22057452 ATGGAAGGGATGGACTGTGGGGG + Intronic
1037935225 8:22911019-22911041 AGGGGAGGCTGTGCCTGTGTGGG + Intronic
1038022877 8:23564565-23564587 AGGGAATGTAGTGACTTTGGTGG + Intronic
1038177485 8:25194449-25194471 AGGGAAGGCAGGGAGGATGGAGG - Intronic
1038277518 8:26134319-26134341 AGGGAGGGCAGTGGCTGATGGGG - Intergenic
1038327214 8:26580151-26580173 AGGTACCACAGTGACTGTGGAGG + Intronic
1038473877 8:27848209-27848231 GGGGAAGGCTGTGCATGTGGAGG - Intergenic
1038868883 8:31470993-31471015 AGAGAAGGGAGTGAATGTTGTGG - Intergenic
1040384265 8:46903056-46903078 AGGGAAGGGAGAGACACTGGGGG + Intergenic
1041160304 8:55035065-55035087 TGGGAAGGTAGTGTGTGTGGTGG + Intergenic
1041394435 8:57376628-57376650 AGGCCAGGCAGGGGCTGTGGTGG + Intergenic
1042706502 8:71669405-71669427 AAGGGAAGCAATGACTGTGGTGG - Intergenic
1043112773 8:76208984-76209006 AGGGATGGGAGTTACAGTGGAGG - Intergenic
1044347986 8:91128898-91128920 AGGAAAGGCTGTGAATGGGGTGG + Intronic
1045011667 8:97964077-97964099 ATGAAGGGCAGTGACTGTGGAGG + Intronic
1045330963 8:101155268-101155290 AGGGAAGGAAGGGGCTGGGGAGG + Intergenic
1045753715 8:105516350-105516372 TGGGAAGGCAGTGTGTGTGTTGG + Intronic
1046074357 8:109299261-109299283 AGGGAAGGGTGTGAATCTGGTGG + Intronic
1046634253 8:116655289-116655311 AGCTAAGGCAGTCACGGTGGAGG + Intronic
1047866853 8:129034069-129034091 AGGGAAGTCAGAGACTGAGAAGG + Intergenic
1047952184 8:129944000-129944022 AGGGTTGGCAGGGATTGTGGGGG + Intronic
1048541213 8:135343817-135343839 AGGGTAGGCAGGGACTGCCGAGG - Intergenic
1049211501 8:141388556-141388578 ACGGAAGGCAGGCACTGAGGAGG + Intergenic
1049448135 8:142641094-142641116 AGGGAAGCCAGGGACTCTGTGGG - Intergenic
1050413924 9:5394914-5394936 AGGGAAGGCAATGAGGGTGAGGG + Intronic
1053023762 9:34714161-34714183 AGGGCAGGGAGTGACTCTGTTGG + Intergenic
1054998062 9:71415114-71415136 AGAGAAGGCAATGACCATGGAGG + Intronic
1055140848 9:72875433-72875455 AGAGAAGGCTGTGGCTGGGGAGG - Intergenic
1055276967 9:74628984-74629006 TGGTAAGGCAGTTACTTTGGTGG - Intronic
1055582849 9:77726128-77726150 ATGGAAGGAAGTGACTGTGTGGG - Intronic
1055907784 9:81314241-81314263 AGGGATGGCAGCAGCTGTGGTGG - Intergenic
1055947824 9:81707232-81707254 TGGGAAGGTAGTGATGGTGGTGG + Intergenic
1055954059 9:81757561-81757583 GGGGAAGGCTCTGACTGTGCTGG + Intergenic
1056471226 9:86905929-86905951 AGGGAAGGCACTGAAGGAGGGGG + Intergenic
1056711688 9:88996801-88996823 AGGGGAGTCAGTCACTCTGGCGG - Exonic
1056938633 9:90936942-90936964 AGGGAAGCCTGTGACACTGGTGG + Intergenic
1057171229 9:92964472-92964494 AAGGCAGGAAGTGGCTGTGGTGG + Intronic
1057191861 9:93092846-93092868 AGGGATGGCGGTCACTGAGGTGG + Intergenic
1057304987 9:93906900-93906922 AGGTAAGGCAGGGACTTGGGAGG + Intergenic
1057424006 9:94934248-94934270 AGGGAAGGGAGGGAGGGTGGAGG - Intronic
1057792973 9:98136082-98136104 AGGGCAGGACGTGACTGTTGGGG - Intronic
1058808409 9:108615850-108615872 AGAGATGGCAGTGATGGTGGTGG - Intergenic
1060104328 9:120864018-120864040 AGGGAGGGGAGGGAGTGTGGTGG - Intronic
1060105382 9:120869809-120869831 AGGAGAGGCAGGGACTGGGGAGG + Intronic
1060887797 9:127167871-127167893 AAGGAGTGCAGTGACTGTGAAGG + Intronic
1061427979 9:130512715-130512737 AGTGTAGGCAGTGACTGGAGAGG - Intergenic
1061545548 9:131302240-131302262 AGGGAAGGCAGTTCATGGGGAGG - Intronic
1061716305 9:132520686-132520708 GGGGAAGGCACTGACTGAGAAGG - Intronic
1062516599 9:136940008-136940030 AAGGATGGGACTGACTGTGGGGG + Intronic
1203787469 EBV:135974-135996 AGGGAGGCCAGTGACAGTGAGGG - Intergenic
1187133936 X:16528820-16528842 AGGAAAGGCAGTGACGGTGGGGG + Intergenic
1189288162 X:39866693-39866715 GGGGCAGGCAGTAACAGTGGAGG - Intergenic
1189655550 X:43240777-43240799 AGGCAAGGCAGTGACAGAGGTGG + Intergenic
1189721165 X:43920085-43920107 AAGGAAGAGAGTGACAGTGGTGG + Intergenic
1190107071 X:47568687-47568709 AGGGAGGGCAGTGTCAGAGGTGG - Intronic
1190655730 X:52610843-52610865 AAGGAAGGTAGTGTCGGTGGGGG + Intergenic
1190703048 X:53002413-53002435 TGGGAAGGGAGAGAATGTGGAGG + Intergenic
1191962267 X:66716588-66716610 AGGAAAGGCAGGGACTATGTAGG - Intergenic
1192181269 X:68917181-68917203 GTTGAAGGCAGTGACAGTGGCGG + Intergenic
1193027805 X:76863861-76863883 GGAGATGGCAGTGACAGTGGGGG - Intergenic
1194984906 X:100479846-100479868 AAGGAAGGTAGTGACTGAAGAGG + Intergenic
1195499162 X:105574185-105574207 AGTGAAAGCAGTGACTGGGGAGG + Intronic
1195722689 X:107881421-107881443 AGGGATGGCAGAAAGTGTGGAGG - Intronic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196572807 X:117283470-117283492 AAGGAAAGAAATGACTGTGGTGG - Intergenic
1196918390 X:120561597-120561619 AGGGAAGGTAGTGACGGCGAGGG + Intronic
1198503931 X:137282107-137282129 AGGGGAGGCAGTGAGTGGGAAGG + Intergenic
1198693477 X:139309158-139309180 AGGGAATGCAGTGATTGTATAGG - Intergenic
1199402644 X:147417117-147417139 AGGAAAGGGGGTGACTGTTGAGG + Intergenic
1199665594 X:150094270-150094292 GGAGAAGGCAGTGACCATGGGGG + Intergenic
1201061317 Y:10049306-10049328 AAGGAAAGAAATGACTGTGGTGG + Intergenic
1201771459 Y:17620643-17620665 AGGCAAGTCAGGGCCTGTGGTGG + Intergenic
1201830096 Y:18285343-18285365 AGGCAAGTCAGGGCCTGTGGTGG - Intergenic