ID: 970963233

View in Genome Browser
Species Human (GRCh38)
Location 4:21897959-21897981
Sequence AGGGAAAGTGCAGTGATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 5, 2: 40, 3: 107, 4: 442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970963223_970963233 25 Left 970963223 4:21897911-21897933 CCTGGCAGCAGGCACGTGGTGTA 0: 1
1: 0
2: 2
3: 17
4: 167
Right 970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG 0: 1
1: 5
2: 40
3: 107
4: 442
970963221_970963233 27 Left 970963221 4:21897909-21897931 CCCCTGGCAGCAGGCACGTGGTG 0: 1
1: 0
2: 4
3: 27
4: 224
Right 970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG 0: 1
1: 5
2: 40
3: 107
4: 442
970963222_970963233 26 Left 970963222 4:21897910-21897932 CCCTGGCAGCAGGCACGTGGTGT 0: 1
1: 1
2: 13
3: 268
4: 1706
Right 970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG 0: 1
1: 5
2: 40
3: 107
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970963233 Original CRISPR AGGGAAAGTGCAGTGATTAT GGG Intronic
900787841 1:4659914-4659936 AGGGAAGGGGTAGTGATTTTTGG - Intronic
901397560 1:8992444-8992466 TCTGAAAGTGCAGGGATTATAGG + Intergenic
901531673 1:9857529-9857551 AGACAAAGTGCAGAGATTACAGG - Intronic
901574408 1:10189384-10189406 AAGCAAAGTGCTGGGATTATAGG - Intergenic
903209545 1:21809409-21809431 AGGCAAAGTGCTGGGATTACAGG + Intergenic
905597684 1:39222381-39222403 TCTGAAAGTGCAGGGATTATAGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907023635 1:51094212-51094234 AGGAAAAGTGTAGTGATTTTGGG + Intergenic
907383747 1:54111964-54111986 AGAGAAAGTGAAGAGATTAAGGG - Intronic
907919951 1:58903206-58903228 ATGAAAAGTGCAGGGACTATTGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908401020 1:63773201-63773223 AGGGAAAGTCAAATCATTATGGG + Intergenic
908526835 1:64995999-64996021 ATTGAAAGTGCTGGGATTATAGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910359242 1:86397890-86397912 AGGGGAATTCCAGTGATTAGTGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910881130 1:91923264-91923286 AGGGTAAATGCCGTGATTAAGGG - Intergenic
910984362 1:92991330-92991352 AAGAAAAGTGCTGGGATTATAGG - Intergenic
911000392 1:93158822-93158844 TCGGAAAGTGCTGGGATTATAGG + Intronic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911553545 1:99314511-99314533 AGGGTAAAGGCAGTGATGATAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913543271 1:119842102-119842124 AGGGTAAGTGGGGTGGTTATGGG + Intergenic
914769886 1:150674614-150674636 TGGCAAAGTGCTGGGATTATAGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915201327 1:154231557-154231579 TCGGAAAGTGCTGGGATTATAGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917729104 1:177856349-177856371 TGGGAAAGTGCTGAGATTACAGG - Intergenic
917806384 1:178617717-178617739 ACCGAAAGTGCTGGGATTATAGG + Intergenic
917886793 1:179394116-179394138 AGGGAAAGTGGAATGGTTAAAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918762980 1:188437971-188437993 AGAGAAAGTGCTGAGATTCTAGG - Intergenic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919581688 1:199384366-199384388 AGCCAAAGTGCTGTAATTATAGG - Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920059131 1:203215574-203215596 AGGGAATGAGCACTGATCATAGG + Intronic
921713386 1:218395074-218395096 AGGAAAAGTGCAGTCATTTCTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921769648 1:219021483-219021505 AGGAAAAGTTCAGTAATTTTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1063469021 10:6269553-6269575 GGGGAAAATGCAGTGAATATAGG + Intergenic
1064962493 10:20981046-20981068 TCACAAAGTGCAGTGATTATAGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066287276 10:33980635-33980657 GGAGAAAATGCGGTGATTATGGG - Intergenic
1066455073 10:35565515-35565537 AGGCAAAAGGCAGGGATTATGGG - Intronic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067352816 10:45492258-45492280 AGAAAAAGAGCAGTGTTTATTGG - Intronic
1068323510 10:55452343-55452365 AGGGAAACTTCAGAGATAATAGG + Intronic
1068935097 10:62628092-62628114 AGGGAAAGCGCAGTGAGGAAAGG - Intronic
1069187353 10:65441294-65441316 AGGAAAAGTACAGCTATTATTGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070024683 10:72621237-72621259 AGCCAAAGTGCTGGGATTATAGG - Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071408756 10:85365697-85365719 AGGGAAGGAGCAGTGAGTTTGGG - Intergenic
1072439837 10:95444353-95444375 TCTGAAAGTGCAGGGATTATAGG + Intronic
1072890470 10:99319229-99319251 AGGGAAAGTGAAGTGAAAAGTGG - Intergenic
1073766075 10:106684396-106684418 AGGGAAAGCACAGTGTTTAATGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075812319 10:125233423-125233445 ATGGAAACTGCAGTGGCTATTGG - Intergenic
1077928049 11:6702061-6702083 AGAGAAGGTACAGTGATTAGAGG + Intergenic
1078244718 11:9563618-9563640 AGGGCAAGTGCAGCTATTGTGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079418233 11:20260711-20260733 AGGCAAAATGCACTGACTATGGG + Intergenic
1079521622 11:21334216-21334238 AGGAGAAGTGCAGATATTATGGG + Intronic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080748460 11:35130146-35130168 AGGGAAAGTGGGGCGTTTATTGG + Intergenic
1080961381 11:37164565-37164587 TCCGAAAGTGCTGTGATTATGGG - Intergenic
1081155987 11:39691537-39691559 AGAAAAAGTGAAGTCATTATAGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081589595 11:44411991-44412013 AGGGAAAATAAAGAGATTATAGG - Intergenic
1082019448 11:47519605-47519627 AGTGCAAGTGCTGGGATTATAGG - Intronic
1084315268 11:68342176-68342198 TCGGAAAGTGCTGGGATTATAGG + Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085127159 11:74009609-74009631 TGGCAAAGTGCTGGGATTATAGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1088051225 11:105517735-105517757 AGGGAAAACGTAGAGATTATGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089488490 11:118865636-118865658 ACCCAAAGTGCTGTGATTATAGG + Intergenic
1090052399 11:123391156-123391178 AGGGCAAGTGGCGGGATTATGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091655964 12:2347227-2347249 GGGGAAAGTGCAGTGTTCGTGGG - Intronic
1092452512 12:8616137-8616159 AGCCAAAGTGCTGTGATTACAGG + Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092797037 12:12121985-12122007 AGGGAAATTGCTGTGATTGGGGG + Intronic
1093603450 12:21059713-21059735 ATGGAAATTGCATTGAATATAGG + Intronic
1095719532 12:45385691-45385713 AGGGGAAATGAAGTGAGTATTGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097764952 12:63515131-63515153 AGGGAAAATGCTGTGATATTAGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098060201 12:66553750-66553772 AGGAAAAGTGCTGTGATTTTGGG + Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1099319466 12:81127742-81127764 AGTAAAAATGCAGTGATCATGGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099676293 12:85764941-85764963 CTGGAAAGTGCTGGGATTATAGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100291153 12:93215968-93215990 AGGGAAGGGGCAGTGAGTAAAGG - Intergenic
1101601655 12:106215111-106215133 AGGCAAATTGCATTGTTTATGGG - Intergenic
1102332415 12:112045534-112045556 ACTCAAAGTGCTGTGATTATAGG - Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104279363 12:127360411-127360433 AGGGCAACTGTAGGGATTATGGG + Intergenic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1105977878 13:25489289-25489311 AGGGAAAGTGCCGTGATTAAAGG - Intronic
1106765664 13:32911241-32911263 ATGAAAAGTGAAGTCATTATTGG + Intergenic
1107286521 13:38799866-38799888 AGGTAAAGTGCATTTCTTATAGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109148081 13:58807689-58807711 AGGTAAGGAGCAGTGATTCTAGG - Intergenic
1109849238 13:68038832-68038854 AGGGGAAATGCTGTGATGATTGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110692188 13:78443732-78443754 AGGTGAAGTGCAGTGGTTTTTGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1112022799 13:95386118-95386140 AGGGAATGGGCACTGATGATTGG - Intergenic
1112272779 13:97985087-97985109 AGGAAAAGAGCATTCATTATAGG + Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1114748935 14:25182113-25182135 AGGGAAATTGCATTGTTAATAGG - Intergenic
1115341372 14:32296294-32296316 AGGTAATGTGCATTGATTAGGGG + Intergenic
1116290689 14:43034508-43034530 TTGGAAAATGCAGTGAATATTGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116617771 14:47160433-47160455 AGCCAAAGTGCTGGGATTATAGG - Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117774851 14:59173210-59173232 AGCAAAAGTGCTGGGATTATAGG - Intergenic
1117981244 14:61344141-61344163 AGGGAACTTGCAGAGATCATTGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1123714411 15:23015643-23015665 AAAGAAAGTGCTGGGATTATAGG + Intronic
1124061176 15:26294839-26294861 AGTGAAAGTGCAGGGATGACAGG - Intergenic
1124138225 15:27054001-27054023 AGTCAAAGTGCAGGGATTAGAGG - Intronic
1125977902 15:43971957-43971979 AGGCAAAGAGCTGGGATTATAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1129665186 15:77575668-77575690 AGGGAAAGTGCTGAGCTTGTTGG - Intergenic
1131166266 15:90144215-90144237 AGTGAAAGTGCTGGGATTACAGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1133865191 16:9635722-9635744 TGGCAAAGTGCTGGGATTATAGG - Intergenic
1134160060 16:11880584-11880606 TCCGAAAGTGCAGGGATTATAGG + Intronic
1134409458 16:13991875-13991897 AGAGAAAGGGAAGTGACTATGGG - Intergenic
1135298388 16:21302387-21302409 TGTGGAAGTTCAGTGATTATAGG + Intronic
1138546738 16:57724062-57724084 ACCCAAAGTGCTGTGATTATAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141487535 16:84350850-84350872 TCGCAAAGTGCAGGGATTATAGG - Intergenic
1142970059 17:3605248-3605270 TCGGAAAGTGCTGGGATTATAGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144319240 17:14097719-14097741 ATTGACAGTTCAGTGATTATGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145797068 17:27661809-27661831 AGGGAAAGTGCAGGGCTTCTCGG - Intergenic
1145811423 17:27766484-27766506 AGGGAAAGTGCAGGGCTTCGTGG - Intronic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146842034 17:36162915-36162937 AGGGAAAGTGTAGAGCTTCTCGG + Intergenic
1146854343 17:36250875-36250897 AGGGAAAGTGTAGAGCTTCTTGG + Intronic
1146870246 17:36374767-36374789 AGGGAAAGTGTAGAGCTTCTTGG + Intronic
1146877603 17:36425848-36425870 AGGGAAAGTGTAGAGCTTCTTGG + Intronic
1147073127 17:37975391-37975413 AGGGAAAGTGTAGAGCTTCTTGG + Intergenic
1147084649 17:38054929-38054951 AGGGAAAGTGTAGAGCTTCTTGG + Intronic
1147100596 17:38178895-38178917 AGGGAAAGTGTAGAGCTTCTTGG + Intergenic
1147575165 17:41594768-41594790 AGGGAAAGTGGAGGGATGAACGG + Intergenic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148827970 17:50408296-50408318 AGCAAAAGTGCTGGGATTATAGG + Intergenic
1148921090 17:51035049-51035071 TGCCAAAGTGCAGGGATTATAGG - Intronic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149416553 17:56465850-56465872 AGGGAATGTGCAGTCATTTGGGG + Intronic
1149437272 17:56643960-56643982 AGGGACAGTGCAGTCATCAAGGG + Intergenic
1149500463 17:57148450-57148472 GGGGAAAGTGCACTGATCTTAGG + Intergenic
1150083537 17:62261941-62261963 AGGGAAAGTGTAGAGCTTCTCGG + Intergenic
1150180911 17:63119966-63119988 AGTGATAGTGGAGTGATCATGGG - Intronic
1150566707 17:66348198-66348220 TCGTAAAGTGCTGTGATTATAGG + Intronic
1151653097 17:75481949-75481971 TGCTAAAGTGCTGTGATTATAGG - Intronic
1153088511 18:1317650-1317672 AGGAAGAGTGAAGTGATCATGGG + Intergenic
1153918361 18:9766076-9766098 AGGGAAGGTGCAGTGCTTCCTGG + Intronic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156616132 18:38786432-38786454 AATCAAAGTGCAGGGATTATAGG - Intergenic
1156625579 18:38903603-38903625 TGAGAAAGTACAGGGATTATTGG + Intergenic
1157100425 18:44724197-44724219 AGGGAAGTTGCAGTGGTTAGAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159691810 18:71497435-71497457 AGGGAAAATGCAGTGGTCAATGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1162485349 19:10956939-10956961 AGAGAAAGTGCTGGGATTACAGG + Intergenic
1163157766 19:15448872-15448894 GGGAAAAGTGCAGGGATCATTGG - Intronic
1165178386 19:33946837-33946859 TGGAAAAGTGCTGGGATTATAGG + Intergenic
1165187622 19:34035671-34035693 AGGGAAAGGGCACTGCTGATTGG + Intergenic
1165324585 19:35106929-35106951 AGTGAAAGTGTAGAGATTCTGGG + Intergenic
1165538032 19:36466813-36466835 CGGCAAAGTGCTGGGATTATAGG - Intronic
1165692813 19:37876765-37876787 AGGGAAAGTGCTGGGATTACAGG + Intergenic
1167977626 19:53243169-53243191 ATGGAAAGTGAAGTGAAAATAGG - Intronic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168712311 19:58508717-58508739 ACCCAAAGTGCAGGGATTATAGG + Intronic
1202669783 1_KI270709v1_random:40107-40129 AGGGAAAATGCCGTGGTGATGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925870812 2:8268693-8268715 AGGGAAAGTGCAGGCATTGCTGG - Intergenic
926971835 2:18474440-18474462 AGGGTAACTGCAGTGTGTATGGG - Intergenic
927162580 2:20281719-20281741 AGGGAAAATCCAGTGAACATGGG - Intronic
927243736 2:20940464-20940486 AGGGAAAATGCAGGGATTACGGG + Intergenic
928124472 2:28606190-28606212 AGGGAAAGTGGAATGAATATGGG - Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928695806 2:33848847-33848869 ATGGTAAATGCAGTGATTAAGGG + Intergenic
928997436 2:37308400-37308422 AGGTAAATTTCAGTGATTAAAGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929769627 2:44880803-44880825 AGGGAAAATGCAGAGATTTAAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930293347 2:49523691-49523713 AGTCAAGTTGCAGTGATTATTGG + Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931472581 2:62553861-62553883 AGGGAAAGGGCAGTGGGAATGGG - Intergenic
931503803 2:62901704-62901726 TTGGAAAGTGCTGGGATTATAGG - Intronic
932064178 2:68535845-68535867 AAGAGAAGTGCAGTGTTTATGGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
932957222 2:76366548-76366570 AGTGAAAGTGCTGGGATTATGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935413840 2:102793944-102793966 ACCCAAAGTGCAGGGATTATAGG - Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
935964486 2:108460256-108460278 AGGGAAAGTGCATTTTTTGTGGG + Intronic
936102831 2:109598367-109598389 AGTTAAAGTCAAGTGATTATAGG - Intronic
936292909 2:111240309-111240331 ATGGAAAGTGCATTGTCTATAGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936931137 2:117790049-117790071 AGGGAATGTGGTGTGAATATGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938418234 2:131122171-131122193 AGGCAAAGTGCTGGGATTACAGG + Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938945663 2:136209892-136209914 AATGAAAGTTTAGTGATTATTGG + Intergenic
939176692 2:138757378-138757400 AGGGAAGGTGGAATCATTATAGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940559959 2:155282274-155282296 AGGAGAAGTGCAGTGATTATGGG - Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941099845 2:161283500-161283522 AGGAAAAATGCACTGATTTTAGG - Intergenic
941459826 2:165756198-165756220 AGGGAAGGTGGAGTATTTATTGG - Intronic
941722811 2:168829825-168829847 AGGGAAGGGGCAGTGGTTAAGGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942577134 2:177375587-177375609 AGAGACAGTGCCCTGATTATGGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944259905 2:197665663-197665685 AGGTAAAGTGCATTTCTTATAGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946151354 2:217773781-217773803 ATGGAAACTGCATTGATTTTTGG + Intergenic
946291177 2:218746597-218746619 ATGGAATGTGCAGTGATCATAGG - Intronic
946824062 2:223658046-223658068 TGGAAAAGTGCTGGGATTATAGG + Intergenic
947195910 2:227567566-227567588 AGAGAAAGTCCAGTGTTTATAGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168830721 20:844049-844071 AGGCAAAGGGCAGAGCTTATAGG - Intronic
1169787404 20:9374702-9374724 AGGATAAGTGCAGTATTTATAGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1172438864 20:34951355-34951377 AGAGAAGGTAGAGTGATTATGGG + Intronic
1174330958 20:49817067-49817089 CGCGAAAGTGCTGGGATTATAGG - Intronic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174464694 20:50708179-50708201 ATGGAAAGTGCTGGGATTACAGG - Intergenic
1174598560 20:51705153-51705175 AGGGAAGGTGCATTCATTAATGG - Intronic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175049625 20:56142656-56142678 AAGGAAAGTCTAGTGATTAGTGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177138641 21:17333643-17333665 GGGGAAAGTGGAGAGATAATGGG + Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1178269554 21:31177346-31177368 TCCGAAAGTGCAGGGATTATAGG - Intronic
1179063387 21:38001205-38001227 AGGGATAGTGGAGAGAGTATTGG - Intronic
1179181133 21:39046247-39046269 AGGGAAAGGGGAATGATTAATGG - Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180998049 22:19975246-19975268 AGGGACAGGGCAGTGCCTATTGG - Intronic
1182725827 22:32444551-32444573 AGGGAAGGTGTGGTCATTATTGG + Intronic
1203294488 22_KI270736v1_random:28551-28573 AGGGATAGTGCAGAGTTGATGGG + Intergenic
949928484 3:9060074-9060096 AGGGGAAGGGCAGTGATTTGGGG - Intronic
950211691 3:11127966-11127988 AGGGAATTTGCAGACATTATAGG - Intergenic
950403919 3:12792725-12792747 TGCGAAAGTGCTGGGATTATAGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951771241 3:26259861-26259883 AGGGAAAGTCCAGTTCTTACAGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953455850 3:43041896-43041918 ATGGAAAGTGCTGGGATTACAGG - Intronic
953575262 3:44108278-44108300 AGGGAAAGGGCAGTGTTCAGTGG + Intergenic
953733157 3:45467074-45467096 ATGGAAAGTGTGGTGATTAGAGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958426777 3:93987902-93987924 ACCCAAAGTGCTGTGATTATAGG + Intronic
959210412 3:103371709-103371731 AGGGAAAATGCAGTCAATTTAGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960483847 3:118226934-118226956 ATGAAAAGTGAAGTGAATATAGG - Intergenic
960837333 3:121920157-121920179 AGTGACAGTGGAGTGATAATAGG - Intronic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962005783 3:131348291-131348313 AGGGAAAATGGAGTAAATATTGG + Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970249000 4:14094325-14094347 AGGGAAAGTGTAGATAATATAGG - Intergenic
970924604 4:21436505-21436527 AGGGAATGTGTAGTGATTTTTGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971009076 4:22411338-22411360 TCGGAAAGTGCTGGGATTATAGG - Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
973006944 4:45020353-45020375 AGGAACAGTGCAGTGAAAATTGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974461151 4:62189634-62189656 AGGGAAATTAAAATGATTATTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975463570 4:74683584-74683606 AGGGAAGGCGCAGTGATATTGGG - Intergenic
976444010 4:85109748-85109770 AGGAAAAGTGTAGTGACTACGGG + Intergenic
976508335 4:85876914-85876936 ATGGAAAGTCCAGTGAATAATGG - Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976748328 4:88428391-88428413 ATGGAAGGTGGAGTGATTGTAGG - Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977332420 4:95654059-95654081 AGGGAAAGTGTAGGTACTATCGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978847068 4:113285944-113285966 ATGTAAACTGCAGTGAATATAGG - Intronic
979184522 4:117772046-117772068 AGGGAGAGTGCAGACATTAAGGG + Intergenic
979190595 4:117852014-117852036 AGAGAAAGTGCATTTCTTATAGG - Intergenic
979540766 4:121878792-121878814 TAGGAAAGAGCAGTGACTATGGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979913240 4:126396966-126396988 AGGGATAGTGCAATGAATATGGG - Intergenic
979929536 4:126613837-126613859 AGGGAAAATGCTGTGAATTTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981805303 4:148708204-148708226 AGGCAAAGTGCTGGGATTACAGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982484503 4:155951407-155951429 AGTGAAAGTGCAGAGATAAGGGG + Intronic
982510034 4:156270966-156270988 AAGAAACGTGCAGTGAATATTGG + Intergenic
982663851 4:158236743-158236765 TGGCAAAGTGCTGGGATTATAGG + Intronic
982779509 4:159476229-159476251 TTGGAAAGTGCTGGGATTATAGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983671677 4:170245552-170245574 AGGGAAGGTGCCGTGCTTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987305335 5:16632221-16632243 TGGGAAAGTGCTGGGATTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988058084 5:26126686-26126708 AGAAAAATTGCAGAGATTATTGG + Intergenic
988335428 5:29902310-29902332 AAAGAAAGTGCAGTGATTCAAGG + Intergenic
989015786 5:36931573-36931595 CTGGAAAGTGCTGGGATTATAGG + Intronic
989162314 5:38403449-38403471 AGTGCAAGAGCAGTGATTCTGGG - Intronic
990982008 5:61610534-61610556 AGTGTCAGTGCAGTGTTTATGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991222588 5:64234205-64234227 ATCCAAAGTGCTGTGATTATAGG - Intronic
992082632 5:73249409-73249431 AGGGAAGGTGCTGTGCTTACAGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993349081 5:86824488-86824510 TGGGTAAGTGTAGTGATTAAAGG + Intergenic
994213159 5:97108543-97108565 AGGGACAGTCCAGTACTTATGGG - Intronic
994310750 5:98267706-98267728 AGGAAAAGTGCAGCGGTTGTGGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994640369 5:102401040-102401062 AGGAAAAGTACAGGGAATATTGG + Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995356187 5:111240244-111240266 AGGTAAGTTGCAGTGATTCTGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995880707 5:116841783-116841805 ACGAAAAGTGCTGGGATTATAGG - Intergenic
996375527 5:122802684-122802706 AGGGACACTGCAATGATTAAAGG + Intronic
997243479 5:132325951-132325973 AGGGAAAGGGTAGTAATTTTTGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997508752 5:134438662-134438684 AGGGAAAGTGATGTGATTAGAGG + Intergenic
998895224 5:146791834-146791856 AGGGAAAGTCAGGGGATTATTGG - Intronic
999253281 5:150195234-150195256 ACTGAAAGTGCAGTGATCATCGG - Intronic
999257947 5:150220275-150220297 GGGGAAAGAGCAGTGATTTGGGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001141059 5:169144371-169144393 AGGAAAAGTACAGAGACTATGGG - Intronic
1001233856 5:170013148-170013170 AGGGAAAGGGCAGGTATTCTAGG + Intronic
1001370034 5:171190576-171190598 AGGGAACTTGAAGTGATTCTTGG - Intronic
1002497630 5:179626049-179626071 AGAGAAAGTGCTGGGATTACAGG + Intronic
1003852083 6:10235408-10235430 GGAGAAAGTGGAGTGATTACTGG - Intergenic
1004267634 6:14162910-14162932 AGGGAAGATGCAGTCATTAAAGG + Intergenic
1006126512 6:31842220-31842242 AGTGAAAGTGCTGTGATTCTAGG + Intergenic
1007905487 6:45455788-45455810 AGAGAAACTGCAATTATTATTGG + Intronic
1008090407 6:47288372-47288394 AGAGAAGGTACAGTGATTAGAGG + Intronic
1008333070 6:50265673-50265695 AAGGAAAGTACAATCATTATGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009744737 6:67798298-67798320 AGGGAAATTGGAGTGGTTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011479046 6:87776128-87776150 AGGGAAAGTGCAGTGTGTTTAGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012113861 6:95268573-95268595 GGAGAAAGAGCAGTGATAATGGG - Intergenic
1012280408 6:97321474-97321496 AAGCAAAGTGCTGGGATTATAGG + Intergenic
1012732991 6:102905308-102905330 TCCGAAAGTGCTGTGATTATAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1014540737 6:122672873-122672895 AATGAAAGTGCAGTAATTCTTGG - Intronic
1014911964 6:127105197-127105219 AGGGAAAGAGCAATTAATATAGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016395677 6:143621179-143621201 AGGGAATGTGGACAGATTATAGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016731527 6:147432913-147432935 TAGAAAAGTGCAGTGATTTTGGG - Intergenic
1018037886 6:159897219-159897241 AGGGAATGTGGAGTGCTGATTGG + Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019764275 7:2838319-2838341 AGCCAAAGTGCCGAGATTATAGG - Intronic
1020197267 7:6050901-6050923 AGGGTAAGAGAAGTAATTATAGG - Intronic
1020227514 7:6291753-6291775 TGTGAAAGTGCTGGGATTATGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021022889 7:15625667-15625689 ATGGACAGTGCAGTTATGATTGG - Intronic
1021045028 7:15912301-15912323 AGGGAAAATGCATTGATTAATGG + Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021361918 7:19725654-19725676 AGGCAAGGTGCAGTGGGTATAGG + Exonic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023110354 7:36804798-36804820 ATGGAAAGTCCAGTGTCTATTGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023998149 7:45174560-45174582 AGGGATGGTGCAGTGGCTATAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025185760 7:56857029-56857051 TGGGAAAGTGCTGGGATTATTGG - Intergenic
1025686169 7:63719915-63719937 TGGGAAAGTGCTGGGATTATTGG + Intergenic
1026351433 7:69518780-69518802 AGGGAAAGTGCACTGTTGAAAGG + Intergenic
1026357284 7:69569615-69569637 TGGGAAGGTGGAGTGGTTATAGG - Intergenic
1026541910 7:71287034-71287056 AGTGAAAGTGCTGGGATTACAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028353520 7:89879015-89879037 TAGGAAAGAGAAGTGATTATGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030842833 7:114377385-114377407 AGAGAAAGTGAAGTCATTCTGGG + Intronic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031448020 7:121878923-121878945 AGGGAAAGACCAGTGAAAATTGG - Intronic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1033253965 7:139783504-139783526 AGAGAAATTTCTGTGATTATGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033884276 7:145926576-145926598 AAGGAAAGTGCATTGATAAGTGG - Intergenic
1034118914 7:148609594-148609616 AGAGAAAGTCCAGTTGTTATTGG - Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1038754546 8:30328392-30328414 AGGGAAAGTGCAGAGATCCTAGG - Intergenic
1038832925 8:31082780-31082802 AGAGAAAGTGCTGGGATTACAGG + Intronic
1039721320 8:40167802-40167824 TGGGAAAGTGCTGGGATTACAGG - Intergenic
1040087003 8:43353928-43353950 ACCGAAAGTGCTGGGATTATAGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1041979915 8:63845896-63845918 AGGGAAAGTCCAGTGATAACGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1043847474 8:85178595-85178617 AGGGGATTTGCAGTGATTATTGG - Intronic
1044481659 8:92697722-92697744 AGTGAAAGTGCTGGGATTACAGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1044949830 8:97424964-97424986 AGGGTCAGTGCAGTGATTAAGGG + Intergenic
1046018655 8:108636802-108636824 AGTGAAAGTGCTTTGATTCTGGG + Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047031985 8:120891906-120891928 AGGGAAAGTGAAATGGTTGTGGG - Intergenic
1047577276 8:126171009-126171031 AGAGAAAGTGCAATGGATATTGG + Intergenic
1050760980 9:9070707-9070729 TGCCAAAGTGCAGTGATTATAGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051063605 9:13074511-13074533 AGGGCAAATGCTGGGATTATAGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052642915 9:31192433-31192455 AGGAAAAGTGCAGGTATTATGGG + Intergenic
1054833022 9:69647012-69647034 AGGGAAAATGCAGGCAGTATTGG - Intronic
1055141017 9:72877078-72877100 AGGGAATGGGGAATGATTATTGG + Intergenic
1055582115 9:77716906-77716928 ATTGAAAGGGCAGTGATCATTGG + Exonic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056790080 9:89619662-89619684 AGGGAAGGTGCAGTGAATGCTGG + Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058500967 9:105615754-105615776 AGGGAAAGAGCAGCGTATATAGG - Intronic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060059650 9:120447657-120447679 AGGGAACTTGCAGTGCTCATAGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060463921 9:123885458-123885480 AGAGAAAGAGAAGTGATTAGTGG - Intronic
1061126184 9:128677536-128677558 ACGCAAAGTGCTGGGATTATAGG - Intergenic
1061326125 9:129865786-129865808 TCCGAAAGTGCTGTGATTATAGG + Intronic
1186951248 X:14627964-14627986 ACGGAAATAGCATTGATTATAGG + Intronic
1186985654 X:15011097-15011119 AGGGAAAGAGAAGTAATTATGGG + Intergenic
1187208262 X:17203511-17203533 AGGGAGAGTGCACTATTTATTGG + Intergenic
1187531904 X:20104883-20104905 AGGGAAAGTGTATTGTTCATGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192773833 X:74221582-74221604 ACCGAAAGTGCTGGGATTATAGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193981931 X:88192038-88192060 ACCGAAAGTGCAGGGATTACAGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195418294 X:104643977-104643999 AGGGAAAGTGTAAGGATTAAAGG + Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196918533 X:120562759-120562781 ATGGAAAGTGCAGTGAGGCTGGG + Intronic
1196922515 X:120599201-120599223 TGGGAAAGTGCTGGGATTACAGG - Intronic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198707013 X:139460758-139460780 TTCTAAAGTGCAGTGATTATAGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198826857 X:140707433-140707455 AGGCAAAGTGCTGGGATTACAGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199341431 X:146681784-146681806 AGAGAAAGTGAAGAGCTTATTGG - Intergenic
1199755217 X:150857935-150857957 AGGTAAAGTGCACTTCTTATAGG - Intronic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201687877 Y:16727393-16727415 ATAAAAAGTGCAGTGTTTATAGG + Intergenic