ID: 970963703

View in Genome Browser
Species Human (GRCh38)
Location 4:21903078-21903100
Sequence CAGTGGCTACGTGATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970963703 Original CRISPR CAGTGGCTACGTGATAAAGT AGG (reversed) Intronic
908861563 1:68496116-68496138 CAGTGTGCACCTGATAAAGTAGG + Intronic
918346402 1:183610913-183610935 CAGTAGATAAGTGATAGAGTAGG + Intergenic
1068385739 10:56324978-56325000 AAGTGGCTAAGTGATGAAGCAGG - Intergenic
1073679296 10:105684910-105684932 CATTGGCTTGGTGATTAAGTGGG - Intergenic
1076403076 10:130195868-130195890 CAATGGGTGCGTGATACAGTGGG - Intergenic
1080306702 11:30844416-30844438 CAGAGGCTACATGAGAAAGCTGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1088397593 11:109385606-109385628 CAGTGGCTAATGGATAAAGAAGG - Intergenic
1096589639 12:52649072-52649094 CAATGCCTACATGATAAAGGTGG - Exonic
1099661883 12:85574523-85574545 TAATGCCTACGTTATAAAGTTGG + Intergenic
1101279440 12:103237396-103237418 CAGTGGGTAAGTGACAAAGCTGG - Intergenic
1108543842 13:51470951-51470973 AAATGGCCACGTGATATAGTTGG - Intergenic
1110880056 13:80560325-80560347 CAGTAGCTACGAGTTAAAGTGGG - Intergenic
1112963253 13:105154916-105154938 CAGTGAGTACATGACAAAGTTGG + Intergenic
1120039333 14:79734887-79734909 CAGTGGCTTCTTGAGAAAGCTGG + Intronic
1126473008 15:49035758-49035780 CAGTGGCTTCATGATAATTTTGG + Intronic
1130316930 15:82803938-82803960 CAGTGTCTACCTCATAAGGTTGG + Intronic
1131940932 15:97564134-97564156 CAGTGTCTTCTTGATAAAGCAGG + Intergenic
1133299922 16:4776195-4776217 CAGAGGCTACATGATCAAGATGG - Intergenic
1135831884 16:25781671-25781693 CAGCTGGTATGTGATAAAGTTGG + Intronic
1140877514 16:79166435-79166457 CAGTGGCTCTGTGACAAAGGAGG - Intronic
1142056153 16:87997465-87997487 CAGTGTCTTCATGGTAAAGTGGG + Intronic
1163429383 19:17258022-17258044 CTGTTGCTACTTGACAAAGTTGG - Intronic
1165715563 19:38043772-38043794 CAGTGGCTACGATAAAAAGAGGG + Intronic
928989286 2:37215152-37215174 CACTGGCTACAGCATAAAGTAGG + Intronic
931677683 2:64713937-64713959 CACTGGCAAGGAGATAAAGTGGG - Intronic
933002918 2:76949610-76949632 CAGTGGCCACAGGATACAGTGGG + Intronic
933876851 2:86628483-86628505 CAGTGGCTTAGTAAGAAAGTGGG + Intronic
935846207 2:107168239-107168261 CGGTGTCTAGGTGACAAAGTGGG - Intergenic
939173124 2:138718940-138718962 CAATAGCTACTTGCTAAAGTTGG + Intronic
939966067 2:148611593-148611615 CAGATACTAAGTGATAAAGTTGG - Intergenic
940437914 2:153676670-153676692 TAGTGGATACTTGATCAAGTAGG + Intergenic
941630336 2:167877346-167877368 CAGTGGCTGCCTGATACAGCAGG + Intergenic
945131863 2:206582298-206582320 CAGTGGCTAAGAGACAAAGAGGG - Intronic
948218180 2:236247703-236247725 CATTGGATACGTACTAAAGTTGG - Intronic
1180737164 22:18025642-18025664 GAGTGGCTGGGTGATGAAGTGGG - Intergenic
1184050028 22:41997557-41997579 CAGTGGCTGCGTTATGAGGTGGG - Exonic
1184994620 22:48196449-48196471 CAGTGGCTTAGAGATAAAGTGGG + Intergenic
955000350 3:54921699-54921721 TAGAGGCCACGTGATAAACTTGG + Intronic
957541381 3:81574418-81574440 CATCGGCTCAGTGATAAAGTGGG - Intronic
962201165 3:133402210-133402232 CAATGGCTAGGTTAAAAAGTAGG + Intronic
962730046 3:138273571-138273593 CAGTGGATACGTGTCAGAGTAGG + Intronic
970963703 4:21903078-21903100 CAGTGGCTACGTGATAAAGTAGG - Intronic
978345393 4:107762571-107762593 CAGTGGTTACCTCAGAAAGTTGG + Intergenic
979172557 4:117620568-117620590 CAGTGGTTATGTAATAAAGAGGG + Intergenic
981260674 4:142714978-142715000 CAGTGGCTAGGAAATAAATTAGG + Intronic
984528073 4:180881116-180881138 CAGTGGCTGGGAGAAAAAGTTGG + Intergenic
988921673 5:35948017-35948039 CAATGCCTACACGATAAAGTGGG + Intergenic
994519505 5:100813788-100813810 CAGAGGTTAGGTGATAGAGTTGG + Intronic
997061575 5:130510965-130510987 CAGTGGCTAAGTGCAAAGGTGGG + Intergenic
1009640383 6:66327977-66327999 CACTGGCTTCCTGATAAATTTGG - Intergenic
1018693957 6:166375139-166375161 CAATGGCTAAGTGATTAGGTGGG + Intronic
1019256333 7:54702-54724 CAGTGAGTTCGTGATAAGGTAGG + Intergenic
1022898588 7:34778319-34778341 CAGTGGCCATCTGATAAAGCAGG + Intronic
1024672930 7:51612938-51612960 CAGAGGCAACATGATATAGTGGG + Intergenic
1055054737 9:72013371-72013393 CAGTGGGTTCTTGAGAAAGTGGG + Intergenic
1188173750 X:26961999-26962021 CAATGGCTGGTTGATAAAGTTGG + Intergenic
1198365032 X:135931684-135931706 CAGGGTCTAGGTGATCAAGTAGG + Intergenic