ID: 970964316

View in Genome Browser
Species Human (GRCh38)
Location 4:21910178-21910200
Sequence CAAAAGAAGGAGATGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970964316 Original CRISPR CAAAAGAAGGAGATGAGGTC AGG Intronic
900354843 1:2255789-2255811 CACAAACAGGAAATGAGGTCAGG - Intronic
901593084 1:10362773-10362795 TAAAAGATAGAGATGAGGTGGGG + Intronic
902669093 1:17960054-17960076 CAAAAGAAAGAGATGTGTTTAGG - Intergenic
902753317 1:18532592-18532614 CAAGAGACGGAGAAGAGGCCAGG - Intergenic
904138483 1:28332646-28332668 GAATAGAAGGAGATGATGTTTGG + Intronic
904324042 1:29715938-29715960 CAAAATAAGGGGATGGGCTCTGG - Intergenic
905573739 1:39026717-39026739 GAAAAGAATGAAATGAGCTCAGG - Intronic
906320907 1:44814847-44814869 TGAAAGAAGGAGCTGAGGCCGGG - Intronic
906617343 1:47242392-47242414 AAAAAGAAGGGCATGAGATCTGG + Intergenic
906649947 1:47505823-47505845 AAAGGGAAGGAGATGAGGTTTGG + Intergenic
907325586 1:53636905-53636927 GAACAGAAGGAGCTGAGGTAGGG - Intronic
907493093 1:54822191-54822213 CAAAAGAAAGAAATAAGGCCGGG - Intronic
907823425 1:57992527-57992549 CAAAGGAAGGTGATGAGAACTGG + Intronic
908267317 1:62392252-62392274 TAAAAGAAGGAGAGGAGTTAGGG - Intergenic
909150757 1:72001149-72001171 TATAAGAAGCCGATGAGGTCTGG - Intronic
909417426 1:75422921-75422943 CAACAGGAAGAGAAGAGGTCTGG - Intronic
910219986 1:84880306-84880328 GACAAGAAAGAGATGAGCTCAGG + Intronic
912520104 1:110239350-110239372 CAAGAGAAGGAGGTGGGGTGGGG - Intronic
912654056 1:111469789-111469811 CACAAGAAGGAGAGGAGAACTGG + Intergenic
912817495 1:112841231-112841253 TAAATGTAGGAGATGAAGTCAGG - Intergenic
914761781 1:150605052-150605074 CAAAAAAAAGAGATGAGGTGAGG - Intronic
914943721 1:152045438-152045460 CAAGAGCAGGAGGTGAGGTATGG - Intronic
914944518 1:152052286-152052308 AAAAAGAAGCAGTTGAGGGCAGG - Intergenic
915091500 1:153429390-153429412 CAAAAGAAGATGCTGAGGCCTGG + Intergenic
915498821 1:156300350-156300372 CAAAAGAGGGAGGTGATATCTGG - Intergenic
915562983 1:156698372-156698394 CAAAAGAAACAGATGAGGCCGGG + Intergenic
915742232 1:158127693-158127715 CAGAGGAAGGAAATGAGGCCTGG + Intergenic
916180338 1:162078068-162078090 CAAAAGAAGGAGGTATGGGCAGG - Intronic
916794537 1:168153614-168153636 CAAAAGAATAAGATAAGGCCGGG + Intergenic
917256674 1:173123477-173123499 CCAAATAAGGAGATCAGGGCTGG + Intergenic
917416922 1:174820240-174820262 CAAAGGAAGGACATGGGGCCAGG + Intronic
917890476 1:179432719-179432741 TTAAAGAATGAGATGTGGTCGGG - Intronic
918238371 1:182601022-182601044 CAAGAGCAGGAGATGAGGTCAGG - Intronic
918432509 1:184476777-184476799 CAAAGGAAGGAGATGGGGCAAGG - Intronic
918562347 1:185884513-185884535 CAAAAAAGTGAGATGAGTTCAGG - Intronic
918976318 1:191490863-191490885 TAAAAGAAAGAGATGAGCTCTGG - Intergenic
919114559 1:193264493-193264515 CAAAAGGAGGAGAGGAGGTTTGG - Intergenic
919808751 1:201396310-201396332 CAAAGGATGGAGTTGAAGTCTGG - Intronic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
919909896 1:202104482-202104504 AAAAAGAAGAAGAAGAGGTTTGG + Intergenic
919973904 1:202598699-202598721 TAAATGTTGGAGATGAGGTCTGG - Intronic
920896709 1:210058291-210058313 AATAAGCAGGAGATGAGGTAGGG + Intronic
921069435 1:211646729-211646751 CAAAAGAAGGAAAGAAGGTAAGG - Intergenic
922007375 1:221545617-221545639 TAAAAGAAGGTGATGAGAACGGG - Intergenic
923095991 1:230775594-230775616 TACAAGAAAGAGATGAGCTCAGG - Intronic
923657914 1:235934309-235934331 CAAAAGAAGAAGATGGCTTCTGG - Intergenic
924111269 1:240702256-240702278 CAAAAGAAGAAGATGTGGACAGG + Intergenic
924535022 1:244928163-244928185 CAGAAGATGGAGCTGAGGTTTGG + Intergenic
924549670 1:245063718-245063740 CAAAAAAAAGAGTTGAGATCTGG - Intronic
924555771 1:245117347-245117369 CAAAAGAAGGAAACCAGGCCGGG - Intronic
1062785861 10:264139-264161 CAAAAGAAGAGGATGAGGAGTGG + Intergenic
1063222043 10:3978049-3978071 GAGAGGAAGGAGAGGAGGTCTGG - Intergenic
1064351415 10:14580872-14580894 CAACAGAAGGAAATGATCTCTGG - Intronic
1064708298 10:18095521-18095543 CAAAAGAAAGAGAATAGGGCCGG - Intergenic
1064966522 10:21020355-21020377 CATGAGAATGGGATGAGGTCTGG - Intronic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065622815 10:27600536-27600558 TAAAAGAAGGAGATGCAGTTTGG - Intergenic
1065728441 10:28689312-28689334 CAAAAAAATGAGATAAGGCCAGG - Intergenic
1067151654 10:43740060-43740082 AACAAAAAAGAGATGAGGTCAGG - Intergenic
1067220397 10:44339970-44339992 AAAATGAAGGAGATGTGGACTGG - Intergenic
1067222650 10:44355240-44355262 CAACAGGAAGAGCTGAGGTCAGG - Intergenic
1067380848 10:45771741-45771763 CACAAGAAGAAGTTGAGGTGAGG + Intronic
1067735290 10:48845746-48845768 TAAAATAAGGAAATGAGATCAGG + Intronic
1067771493 10:49129817-49129839 CAAAAGAAGAAGATGAGAAGTGG - Intergenic
1067888547 10:50112392-50112414 CACAAGAAGAAGTTGAGGTGAGG + Intronic
1068226617 10:54114868-54114890 GAGAAGTAGGAGATGAGGTCAGG + Intronic
1068346454 10:55785492-55785514 CTAAAGAAGGACATCAGGTTTGG + Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1068897193 10:62219057-62219079 CAAAAGAAGGGGAGGAGGAAGGG - Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070245970 10:74731405-74731427 CATGAGAAGGACATGAGATCTGG + Intergenic
1070951362 10:80433834-80433856 CTAAAGAAGAACCTGAGGTCAGG + Exonic
1071037663 10:81266562-81266584 CAAAAGGATGACCTGAGGTCAGG - Intergenic
1072161421 10:92770844-92770866 TAAAAAAGGGAGATGGGGTCAGG + Intergenic
1072635885 10:97177678-97177700 AAAAAGAAGGAAATCAGGCCGGG + Intronic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1076069149 10:127472232-127472254 CAAAGGAGAGAGATGAGGACAGG + Intergenic
1076190306 10:128478652-128478674 CACAAGAATGAGATGAGGTTGGG - Intergenic
1077139224 11:1016323-1016345 CAACAGAAGGCGATGAAGTCTGG + Exonic
1078009838 11:7564397-7564419 CACAATAAGGAGATGAGGTATGG + Intronic
1078829442 11:14965545-14965567 GGAGAGTAGGAGATGAGGTCAGG + Intronic
1078882637 11:15467070-15467092 CCAAGAAAGGAGCTGAGGTCAGG - Intergenic
1078902208 11:15651941-15651963 AAAGAGAAAGAGAGGAGGTCCGG + Intergenic
1079075779 11:17384783-17384805 CAACAGACAGAGATGAGGCCTGG + Intergenic
1079103530 11:17556499-17556521 CTGAAGCAGGAGATGAGGACAGG - Intronic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1082838925 11:57672678-57672700 CAAAAGAAGGAGAGAATATCAGG - Exonic
1083402065 11:62430376-62430398 CAAGAGAAGGGGATAAGGGCTGG - Intergenic
1085960671 11:81457937-81457959 CAGCAGGAGGAGATGAGGTAGGG - Intergenic
1087191948 11:95264165-95264187 CAAAAGAGTCAGATTAGGTCTGG - Intergenic
1087373401 11:97314167-97314189 AAAATGAAGGAGAGGAGGGCAGG + Intergenic
1088790619 11:113223136-113223158 CAGAAGGAGGAGATGAGCTCTGG - Intronic
1090168920 11:124581233-124581255 GAAAAGCAAGAGATGAGGCCTGG + Intergenic
1091041243 11:132283951-132283973 CAAGAGGAGGAGAGGAGGCCAGG - Intronic
1091349048 11:134878371-134878393 CAAAATAAGAAAAGGAGGTCTGG - Intergenic
1091370779 11:135056331-135056353 CTAGACAAGGAGATGGGGTCAGG - Intergenic
1091442250 12:520412-520434 CAAAATCAGGATATGTGGTCTGG - Intronic
1092209726 12:6638485-6638507 CAAAAGAACGAGAGGTGGGCAGG + Intronic
1092970170 12:13686313-13686335 GAAAAGAAGGAAATGGGGTTTGG - Intronic
1093482572 12:19619873-19619895 AAATAGAAGGAGATAAGCTCAGG - Intronic
1094472341 12:30815119-30815141 CAAAAAAGGGATATGAGGCCAGG - Intergenic
1095641668 12:44493047-44493069 TAGAAGAAAGAGATGAGCTCAGG - Intergenic
1096058251 12:48673650-48673672 CAAAATTAAGAGATGAGGCCAGG + Intronic
1096062570 12:48714201-48714223 CTAAAGAAGTAGATTAGGCCGGG - Intronic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1096687848 12:53300482-53300504 CTAAGGAAGGAGATGAGATAAGG - Intronic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1097092317 12:56516585-56516607 CAAAAGAAGAAGAAGAAATCTGG + Intergenic
1097117494 12:56708438-56708460 CAAAAAAAGGAGAAAAGGCCAGG - Intergenic
1097502953 12:60429138-60429160 AAAGAGAAGGAGAGTAGGTCTGG - Intergenic
1097546952 12:61015212-61015234 AAAAAGAAAGAGAGGAGGACAGG + Intergenic
1097984637 12:65770493-65770515 CCACAGAAGGATATGAGGCCTGG + Intergenic
1098465030 12:70776788-70776810 CAAAAGAAGGGGGAGAAGTCAGG - Intronic
1099129927 12:78815938-78815960 AAAAACAAGGTCATGAGGTCAGG + Intergenic
1099842429 12:87982550-87982572 CAAAAGAAAAACCTGAGGTCAGG + Intronic
1099946490 12:89250622-89250644 AAAATGAAGCAGATGAGGACAGG + Intergenic
1100335707 12:93627020-93627042 CCAATGTTGGAGATGAGGTCTGG + Intergenic
1101143852 12:101822499-101822521 GAAAGGAAGGAAATGAGGACAGG - Intronic
1101358400 12:104003042-104003064 GAAAAGAAGAAGAAGAGGTAGGG + Intronic
1101400746 12:104384617-104384639 CCAAAGAAGGAGAGGAGAGCTGG - Intergenic
1101699640 12:107160307-107160329 GAAAGGGAGGAGAGGAGGTCAGG + Intergenic
1102050815 12:109860807-109860829 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1102051870 12:109868304-109868326 GAAAAAGAGGAAATGAGGTCGGG - Intronic
1102114909 12:110395583-110395605 AAAAAAAAGAAGATGAGGCCAGG - Intronic
1102322229 12:111946441-111946463 CAAAACAAAGAGATGGGCTCTGG + Intronic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103589417 12:121980642-121980664 AATGAGAAGGAAATGAGGTCAGG - Intronic
1104505592 12:129329139-129329161 TATATGGAGGAGATGAGGTCAGG - Intronic
1105208898 13:18246381-18246403 AAAGAGTAGGAGATGAGGCCGGG + Intergenic
1105421498 13:20256282-20256304 AAAAAAATGGATATGAGGTCTGG - Intergenic
1105586048 13:21743733-21743755 CATATGGAGGAGATGAAGTCAGG - Intergenic
1105700345 13:22930927-22930949 TAAAAGAAAAAGATGAGCTCAGG - Intergenic
1105781961 13:23713888-23713910 CAAAAGAGGGTGATGAGAGCAGG - Intergenic
1105803957 13:23938828-23938850 CAAAAGAGGGTGATGAGAGCTGG - Intergenic
1105806759 13:23955955-23955977 CAAAAGAAGGTGATGAGAGCAGG + Intergenic
1105853112 13:24352869-24352891 TAAAAGAAAAAGATGAGCTCAGG - Intergenic
1106017793 13:25885449-25885471 CAAAAGAAGGAGAGAGGGCCAGG - Intronic
1106238187 13:27883706-27883728 AAAAAGAAGGAGAGGAGTTGGGG + Intergenic
1106499341 13:30312076-30312098 CAAAGGGAGGAGAGGAGGTTGGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1109991927 13:70069871-70069893 AGAAAGAAGCAGATGAGGCCGGG + Intronic
1110277893 13:73660528-73660550 CAAAAGAAGGAAAAGAGGGTAGG + Intergenic
1110289216 13:73784929-73784951 CTAAAGAAGGAGATGAGGCCGGG - Intronic
1111460079 13:88527696-88527718 CAAAAGAAGCAGATAAGATAGGG + Intergenic
1111613535 13:90636537-90636559 CAAGAGAAGGGCTTGAGGTCAGG + Intergenic
1111785562 13:92782252-92782274 CACAAGAAGGAGATTTGGTAAGG - Intronic
1111873844 13:93868230-93868252 AAAAAGCATGAGATGAGGTTTGG - Intronic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1113647861 13:112011640-112011662 AAAAAGAAGGAGAAGAGGCCGGG - Intergenic
1113683054 13:112257639-112257661 CAAAAGAAAGATATTTGGTCTGG + Intergenic
1113816863 13:113178022-113178044 CAAATGAAGGAGATTAACTCGGG + Intronic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1115878586 14:37890049-37890071 GAGGAGCAGGAGATGAGGTCAGG + Intronic
1115961890 14:38843412-38843434 GAAAAGAGGAGGATGAGGTCTGG + Intergenic
1116282103 14:42921992-42922014 CAAATGAAAGAGATGAGAACAGG + Intergenic
1116975204 14:51108318-51108340 CAAAAGAAGGAGCTGGGGAAGGG + Intergenic
1117555594 14:56879966-56879988 GAACAGAGGGAGATGAGCTCAGG - Intergenic
1117557972 14:56906256-56906278 CTAAAGTAGAAGATGAAGTCTGG + Intergenic
1118061336 14:62140989-62141011 AAAAAGAAGAACATGAGGTAGGG + Intergenic
1118636182 14:67750723-67750745 CCAAAGATGGAGGTGAGGTGAGG + Intronic
1118646136 14:67842460-67842482 CAAGAGAAGGTGAGGAGGTGAGG - Intronic
1119429161 14:74554843-74554865 AAAAGGAAGGAGGTGAGCTCAGG + Intronic
1119977427 14:79040719-79040741 CAAAAGAAACTGATGAGGGCTGG + Intronic
1121039768 14:90736282-90736304 TAAAAAAAGGGGAGGAGGTCGGG + Intronic
1121048354 14:90804038-90804060 CAAAAGAAAGAGCTGTGGCCGGG + Intronic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1121413556 14:93763692-93763714 CAAGGGAAGGAGCTGAGGACCGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121664173 14:95659235-95659257 CAAAAGAGGGAGGTGAGGAATGG + Intergenic
1122023181 14:98856232-98856254 GAAATGAAAGAGATGAGGTGAGG + Intergenic
1122280776 14:100621005-100621027 CAAATAAAGGATATGAGGACGGG - Intergenic
1122841871 14:104468893-104468915 TAAAAGAAAAAGATGAGCTCAGG - Intergenic
1202881212 14_KI270722v1_random:61900-61922 CAAAAGAAGGCAAACAGGTCAGG - Intergenic
1123708210 15:22966051-22966073 TAAGACAAGGAGATTAGGTCGGG + Intronic
1124104186 15:26722102-26722124 GAAAAGAAGGAAATTAGGTGAGG - Intronic
1124375284 15:29125654-29125676 CAAAAGACAGTGATGAGGACTGG + Intronic
1127089418 15:55451948-55451970 CAAAAGAAGGAAAATAGGTCTGG + Intronic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1128616174 15:69111727-69111749 CAAAAAAAAGAGAGGAGATCAGG + Intergenic
1129293779 15:74588246-74588268 AAAAAGAAGAAGAAGAGGCCTGG + Intronic
1129761741 15:78132712-78132734 AAAAAACAGGAGATGAGGCCGGG - Intronic
1131235472 15:90693049-90693071 AAAAAAAAGAAGAAGAGGTCGGG - Intergenic
1131320593 15:91386352-91386374 GAAAATAAGAAGATGGGGTCCGG + Intergenic
1131620662 15:94064967-94064989 TACAAGAAAGAGATGAGCTCAGG + Intergenic
1131676638 15:94676782-94676804 CAGGAGAAGGAGGTGGGGTCAGG - Intergenic
1131823306 15:96294736-96294758 CAAATGAAGGCATTGAGGTCCGG + Intergenic
1132333627 15:101029276-101029298 CGAAAGAGGGAGTTGGGGTCTGG + Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1133692279 16:8228342-8228364 GAAAAGTAAGAGATGAAGTCTGG - Intergenic
1133729437 16:8567202-8567224 CAAAACAGGGTGATGAGGCCGGG - Intergenic
1134026516 16:10958187-10958209 CAAAGGAAGGAGAACATGTCTGG + Intronic
1134508983 16:14831243-14831265 CAAGAGTAGAAGATGAGGACAGG - Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134696684 16:16230077-16230099 CAAGAGTAGAAGATGAGGACAGG - Intergenic
1134975149 16:18564628-18564650 CAAGAGTAGAAGATGAGGACAGG + Intergenic
1135199932 16:20428532-20428554 CAAAAGAGGGAGAACAGGTCAGG - Intronic
1135218771 16:20595078-20595100 CAAAAGAGGGAGAACAGATCAGG + Intergenic
1135576783 16:23592181-23592203 CAAGAAAACGAAATGAGGTCAGG + Intronic
1135711385 16:24720391-24720413 CAAAAAAAGAAAAAGAGGTCAGG + Intergenic
1135925114 16:26687251-26687273 TAAAATAAGAAGATGAGGCCTGG - Intergenic
1136550224 16:30979108-30979130 CATAGGAAGGAAAGGAGGTCAGG - Intronic
1136588955 16:31205604-31205626 CAAAAGAAGGAAAGGAGGGAAGG - Intergenic
1137435574 16:48451906-48451928 AAAAAGAATGAGATCAGGCCTGG + Intergenic
1137603071 16:49769677-49769699 GAAAGGAAGGAGGTGAGGTTGGG - Intronic
1137627378 16:49918000-49918022 CAAAAGAAGTAGATTAGGCCTGG - Intergenic
1137813441 16:51375322-51375344 TAAAAGAAGAAGCTGAGGTGTGG - Intergenic
1137818775 16:51423830-51423852 CAAAAGGAGGAAATGTGGTGAGG + Intergenic
1139236381 16:65343799-65343821 TAAAAGAAGTAGATGAGGCCAGG + Intergenic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1140309140 16:73832191-73832213 AAAAAAAAGCATATGAGGTCGGG - Intergenic
1140317866 16:73916622-73916644 CAAAAAAATGAGATGAGCACAGG - Intergenic
1140345008 16:74205029-74205051 TAAAAGAATGTGATGACGTCAGG + Intergenic
1140768560 16:78182559-78182581 CAAAAGAAGGAAGGGAGGGCAGG - Intronic
1140869269 16:79091748-79091770 GAAAAGAAAAAGATGCGGTCGGG - Intronic
1141260439 16:82448805-82448827 GAGAAGCAGGAGTTGAGGTCAGG - Intergenic
1141284153 16:82655504-82655526 CAAGAGTAGGAGATGAGATCAGG + Intronic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1142690673 17:1604729-1604751 CAACAGCAGGAGGTGAGGGCAGG - Intronic
1143358767 17:6350820-6350842 AAGAAGTAAGAGATGAGGTCAGG - Intergenic
1144155506 17:12496622-12496644 AAAGAGAAGGGGTTGAGGTCAGG - Intergenic
1144184630 17:12785489-12785511 CAAAAGAAGAGGAGGAGGTGAGG - Intergenic
1144335955 17:14269111-14269133 TAAGAGATGGAGATGAGTTCTGG - Intergenic
1145193860 17:20869623-20869645 CAAAAGAGGGTGATGAGAGCGGG + Intronic
1145298175 17:21611546-21611568 CAAAAGAGGGTGATGAGAGCGGG - Intergenic
1145352081 17:22091849-22091871 CAAAAGAGGGTGATGAGAGCGGG + Intergenic
1145722616 17:27088115-27088137 CAAAAGAGGGTGATGAGAGCAGG - Intergenic
1145953646 17:28839438-28839460 TAACAGAAGGAGAGGAGGACAGG + Intronic
1146698089 17:34927098-34927120 AAAAAGAAGAAGAAGAAGTCTGG + Intergenic
1146946608 17:36877790-36877812 TGGGAGAAGGAGATGAGGTCAGG + Intergenic
1147877331 17:43631013-43631035 AAGAAGAAGAAGATGAGGTGTGG - Intergenic
1147953249 17:44118683-44118705 CAAATGAATGAGATCATGTCTGG - Intronic
1147954597 17:44125298-44125320 CAAAAGAAGAAGAAGAGGCCAGG + Intergenic
1147995285 17:44356668-44356690 GAAAAGGGGGACATGAGGTCAGG + Intronic
1148067696 17:44884594-44884616 CAAAATAAAGAGTTGAGGGCCGG + Intronic
1148261004 17:46183539-46183561 CAAAAGAAGGAAAAGAGGAGAGG + Intronic
1148648277 17:49231381-49231403 CAAAAGGAGGAGATTAGGGTGGG - Intergenic
1149746120 17:59100089-59100111 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1149899008 17:60456646-60456668 GAATGGCAGGAGATGAGGTCAGG - Intronic
1150737751 17:67754780-67754802 CACAAGAAGGAGAGGAGGTAGGG - Intergenic
1150838923 17:68590331-68590353 CAAAAGCAGGAACTGAGGCCTGG + Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1152152887 17:78613917-78613939 CAAAAAAAGGAAATTAGGTGGGG - Intergenic
1152484335 17:80580079-80580101 CTGAAAAAGGAGATGAGATCAGG - Intronic
1152532546 17:80927829-80927851 CAAATGGAGGAGATGAGGGCAGG - Intronic
1153181952 18:2445350-2445372 CAAAAGAAGAAAATGAGGAGAGG + Intergenic
1153661516 18:7330369-7330391 CAGCAGAAGAAGAGGAGGTCAGG - Intergenic
1153931357 18:9882480-9882502 CCAGAGATGGAGATGAGTTCTGG - Intergenic
1155103218 18:22634597-22634619 GAACTGAAGGAGATGAGGCCAGG - Intergenic
1155477199 18:26246826-26246848 AAAAAGAATGAGATTAGGCCAGG - Intronic
1155577832 18:27267235-27267257 GAAAAGAAGTACATGGGGTCAGG + Intergenic
1156564199 18:38164974-38164996 CAAAAGAAATAGATGACCTCAGG - Intergenic
1156867700 18:41907356-41907378 CAGAAGAAGAAGGTGAGGTTGGG - Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1157713264 18:49864444-49864466 CAAAAGAAGGGGAGGAGGGGAGG - Intronic
1158227266 18:55214202-55214224 GAAAAGAAAAAGATGAGCTCAGG - Intergenic
1158302281 18:56065456-56065478 AAAAAAAAGGAGCTGGGGTCGGG - Intergenic
1159200934 18:65183221-65183243 CACAAGAAGAAGAAGAGGCCAGG + Intergenic
1159986860 18:74852680-74852702 CAAAAGAAGGAAGTGAGCTTGGG + Intronic
1160090932 18:75826003-75826025 GAGGAGCAGGAGATGAGGTCAGG - Intergenic
1160097599 18:75889701-75889723 CCAAAGAAGGAGAGAGGGTCAGG - Intergenic
1160694363 19:475354-475376 GAAAAGAAGGAGATGTTCTCAGG + Intergenic
1161284295 19:3460895-3460917 CAAACGAATAAGCTGAGGTCAGG + Intronic
1161500810 19:4614430-4614452 CTAAGGATGGAGATGAGGACAGG + Intergenic
1161653098 19:5497286-5497308 CGAAAGTAGGTGATGAAGTCAGG + Intergenic
1161658852 19:5533538-5533560 GAGGGGAAGGAGATGAGGTCAGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161919556 19:7255872-7255894 CAAAGAAAGAAGATGAGGTTGGG - Intronic
1162259570 19:9521489-9521511 AAAAAGAAGAAGGTGAGGTAGGG - Intergenic
1162307105 19:9881792-9881814 TAAGAAAAGGAGATTAGGTCCGG - Intronic
1162923023 19:13914627-13914649 AAAAAAAAGGCGATGAGGCCTGG - Intronic
1162941790 19:14014858-14014880 TAAAAAAAGTAGATGAGGCCGGG + Intergenic
1163121721 19:15222455-15222477 CAAAGGTAGGAGGTGAGGCCAGG - Intergenic
1163440908 19:17322214-17322236 CAAAGGAGGGAGCTGAGGTAGGG - Exonic
1164292342 19:23879775-23879797 AAAAAGGAGGAGAGGAGGTGGGG + Intergenic
1165245736 19:34497518-34497540 GAAAAGAAGGAGTGGGGGTCAGG + Intronic
1165499413 19:36176038-36176060 CATAATAATGAGTTGAGGTCAGG - Intergenic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1166788488 19:45383589-45383611 TACAAGAAGGAAATGAGGGCCGG - Intronic
1166881155 19:45930891-45930913 AAAGGAAAGGAGATGAGGTCAGG - Intergenic
1167024276 19:46903629-46903651 CTTAAGAAGGAAATCAGGTCTGG - Intergenic
1167429096 19:49443994-49444016 GAAAAGACGGGGAAGAGGTCAGG - Intergenic
1167906113 19:52662024-52662046 CACAGGCAGGAGATGAGATCAGG + Intronic
1168146878 19:54424573-54424595 CAGGAGAAGGAGCTGAGGCCCGG - Intronic
925186987 2:1854806-1854828 CAAGAGAAGGAGACGACGTCAGG - Intronic
925590488 2:5504558-5504580 CAAAGGCAGTAGATGAGGCCCGG + Intergenic
925674222 2:6343217-6343239 GAAAAGAAGAAGATGAGTCCAGG + Intergenic
926347982 2:11966865-11966887 CCAAAGAAGCAGATGAGCTGTGG + Intergenic
926958001 2:18322830-18322852 CAAAATAAGGAGATGCTGTGTGG + Intronic
927319836 2:21730201-21730223 CTAAAGAAGGACATGAGGTGTGG + Intergenic
930179403 2:48337599-48337621 AAAAAGAATGAGATCAGGCCAGG - Intronic
930246601 2:48990015-48990037 CAAAAGGAGGAGATGGGGAAGGG - Intronic
930262774 2:49166638-49166660 CAAAAGAAAGAAAGGAGGTGAGG + Intergenic
930916697 2:56700007-56700029 CAAAAGAAGAAGAAAAGATCAGG - Intergenic
931156018 2:59631090-59631112 CAAAAGGAAGAAAGGAGGTCTGG + Intergenic
931207885 2:60165369-60165391 CAAAAGAGGGAAATGAGTCCAGG + Intergenic
931411158 2:62033206-62033228 AAAAAGAAGTAAATCAGGTCTGG - Intronic
931955363 2:67418414-67418436 CATAAGAAGGACATGAGATTTGG - Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
932621290 2:73266047-73266069 CAAAAGATGGAGAGGAGATGGGG + Intronic
932911607 2:75811944-75811966 CAAAAAAAGGAGAAAAGGTAAGG - Intergenic
934750770 2:96792804-96792826 AAAAAAAAAGAGAGGAGGTCAGG + Intronic
935368140 2:102316352-102316374 AAAAAGTATGAGATGAGGTTCGG - Intronic
936067580 2:109344037-109344059 CAAAAGAAGGATCTGGGGACGGG - Intronic
936771170 2:115915174-115915196 CAAAACAAAGAGATGGGCTCTGG - Intergenic
937333490 2:121046256-121046278 CCAGAGAAGGAGATGAGATAAGG - Intergenic
937493649 2:122395466-122395488 CAAATGAAGGAACTGAGGTTGGG + Intergenic
938342046 2:130542049-130542071 CAACAGAGGGAGAGGAGGCCGGG + Intronic
938347786 2:130578662-130578684 CAACAGAGGGAGAGGAGGCCGGG - Intronic
938852075 2:135271465-135271487 CAAAGGAAGGAAAAAAGGTCAGG + Intronic
939369872 2:141285380-141285402 TAAAAGAAGGAAAAGAGGCCAGG - Intronic
939382612 2:141455550-141455572 AAAAAGATGGAGATGGGGACAGG + Intronic
939511289 2:143109251-143109273 CAAATGAACGAGATGATATCTGG + Intronic
940053859 2:149493005-149493027 CAAGAGATGAAGATGAGGACTGG - Intergenic
940654274 2:156469458-156469480 AAAAAGAATGAGATCAGGCCGGG - Intronic
940741487 2:157514715-157514737 AATAAGAAGTAAATGAGGTCAGG - Intergenic
940951971 2:159685879-159685901 GAAAGGAAGGAGTTGAGGTCAGG - Intergenic
940977917 2:159967080-159967102 CAAGAGTAGGAGATGGAGTCTGG + Intronic
941530406 2:166662941-166662963 CAAAAGAATGAAATTAGGCCGGG - Intergenic
941771375 2:169349431-169349453 GAGGAGAAGGAAATGAGGTCAGG + Intronic
942690133 2:178576271-178576293 AAAAAGTAGGAGACGAGGCCTGG - Exonic
943261010 2:185663637-185663659 CAAAAAAAGGAAACAAGGTCAGG - Intergenic
943541462 2:189220098-189220120 CACAAGAAGGACATGACCTCAGG + Intergenic
943662000 2:190569019-190569041 CAAAAGAAACAGCTGAGGCCAGG + Intergenic
944512388 2:200477476-200477498 GAAAACATGAAGATGAGGTCAGG - Intronic
945765263 2:213968486-213968508 TAAAAGAAGTAGTTGAGGCCGGG - Intronic
946085050 2:217162498-217162520 GAAAGGAAGGAGATGAGTTGGGG + Intergenic
947370652 2:229442096-229442118 AAAAGGAAGGACATGAGGGCAGG + Intronic
948340763 2:237249422-237249444 GAAAAGAAAGAGATCAGATCAGG - Intergenic
1169069313 20:2713069-2713091 CAAAGGAATCAGATGATGTCTGG + Intronic
1169087573 20:2836861-2836883 AAACAAAAGGAGATGAGGGCAGG - Intronic
1170552837 20:17491813-17491835 CAATGGAAGGAGGTGAGGTGAGG - Intergenic
1170691481 20:18619718-18619740 TAAAAGCAGGAGAGGAGGCCAGG - Intronic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1171562418 20:26137136-26137158 CAAAAGAAGGTGATGAGAGCGGG + Intergenic
1172250836 20:33478003-33478025 CGAAAGCAGGAGTTCAGGTCTGG - Intergenic
1172995777 20:39069509-39069531 CAAAATAGGCAGATGAAGTCAGG + Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173631212 20:44517157-44517179 GCAAAGAATGAGATGATGTCAGG + Intronic
1174258905 20:49278814-49278836 CACGAGAAGGAGATTAGGGCTGG - Intergenic
1174593866 20:51668068-51668090 CAAAAGAAGGAAGGGAGGTGGGG + Intronic
1174717672 20:52777248-52777270 CAAAAGAAGGGGATGATTCCGGG + Intergenic
1176847946 21:13890983-13891005 CAAATGTTGGAGATGGGGTCTGG - Intergenic
1177067189 21:16454505-16454527 AAATAGAAGGAAATTAGGTCAGG + Intergenic
1177226472 21:18263780-18263802 AAAAAGAAGAAGATGAAGTAAGG - Intronic
1177515956 21:22151712-22151734 GAAAAGAAGGAAATGTGGCCTGG - Intergenic
1177622435 21:23613499-23613521 CAAAAGAAAAAGATGAGTTCAGG - Intergenic
1180118195 21:45725898-45725920 CCAGTGCAGGAGATGAGGTCAGG + Intronic
1180767364 22:18352934-18352956 AAAGAGTAGGAGATGAGGCCGGG - Intergenic
1180778943 22:18509449-18509471 AAAGAGTAGGAGATGAGGCCGGG + Intergenic
1180811666 22:18766766-18766788 AAAGAGTAGGAGATGAGGCCGGG + Intergenic
1181197819 22:21201017-21201039 AAAGAGTAGGAGATGAGGCCAGG + Intergenic
1181334980 22:22122829-22122851 CAAAAGAGGGTGATGAGAGCAGG - Intergenic
1181401925 22:22654792-22654814 AAAGAGTAGGAGATGAGGCCGGG - Intergenic
1181703880 22:24635882-24635904 AAAGAGTAGGAGATGAGGCCGGG - Intergenic
1181877218 22:25949048-25949070 CAAAAGAAGAGGATCAGATCAGG + Intronic
1181963824 22:26642714-26642736 AGAAAGAAGGAGAGGAGGTGGGG + Intergenic
1182970363 22:34568087-34568109 CTAAAGAAGGAGATAGGTTCAGG + Intergenic
1184542745 22:45140130-45140152 CAAAGGAGGGAAATGAAGTCAGG + Intergenic
1185088104 22:48751645-48751667 TAAAAGAAGGGGCTGAGGTTGGG + Intronic
1203228985 22_KI270731v1_random:93817-93839 AAAGAGTAGGAGATGAGGCCGGG - Intergenic
949090411 3:21303-21325 TAGAAGATGGAGATAAGGTCAGG + Intergenic
950108963 3:10406259-10406281 GAAAAGAATGAGATGAAGTGTGG + Intronic
950116350 3:10452608-10452630 AGAAGGAAGGAAATGAGGTCAGG + Intronic
950341892 3:12254292-12254314 CAAAAGAAAGAGAAGAGGTGAGG + Intergenic
950640877 3:14347227-14347249 CAAAGGCAGGAGATGGGATCAGG + Intergenic
951806956 3:26656010-26656032 ATAGAGAAGTAGATGAGGTCAGG - Intronic
951823182 3:26836864-26836886 CAACAGGGAGAGATGAGGTCAGG + Intergenic
952850823 3:37727630-37727652 CAAAAGAAGGAATTGAGTGCTGG + Intronic
953460318 3:43076629-43076651 CACAAGAGAGAGCTGAGGTCTGG - Intergenic
954117713 3:48476397-48476419 CAAAATAAGGAGAGGAGGAGGGG + Intronic
954147026 3:48639575-48639597 CCACAGAAGGGGATGAGGGCTGG - Intronic
954473580 3:50722015-50722037 CAAAAGAAAGAGGACAGGTCAGG + Intronic
954941165 3:54374611-54374633 CCAGAGAAGGAGCTGAGCTCAGG - Intronic
955292398 3:57704660-57704682 CAGAAGAATCAGTTGAGGTCAGG - Intergenic
955316424 3:57943092-57943114 TAAAAGCAGGAGTTGAGTTCTGG - Intergenic
956997758 3:74847731-74847753 CAGGAGAAGGAGATCAGGTATGG + Intergenic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
957822865 3:85400888-85400910 CTAAAGGAGGAGTTGAGGTAAGG - Intronic
957957282 3:87204126-87204148 GTAAAGAAGGAGAGGAGGACAGG - Intergenic
959265361 3:104130771-104130793 AAAAAGGAGGGGATGAGTTCCGG + Intergenic
960019027 3:112928662-112928684 CAAAATAAAGAGATGAGTTGAGG - Intronic
960438617 3:117658839-117658861 CCAGAGAAGGAGATGAGGGAAGG - Intergenic
961047470 3:123719610-123719632 CACAAGAGGAAGCTGAGGTCTGG + Intronic
961270492 3:125684024-125684046 CACAAGAGGAAGCTGAGGTCTGG - Intergenic
961770704 3:129248099-129248121 CAAAAGAAGAAAATGAGGCCGGG - Intergenic
961796549 3:129412982-129413004 CAATAGAAGGTGGTAAGGTCAGG - Intronic
962026618 3:131554537-131554559 AGAAAGAAGGAGAACAGGTCAGG + Intronic
963214222 3:142725819-142725841 CAAAAGCAGGAGGAGAGGTTAGG - Intronic
963296477 3:143551985-143552007 AAAAAGAAGGAAGTGAGGTTTGG - Intronic
963330024 3:143903858-143903880 CAAAAGAAGCAGATGACATAGGG + Intergenic
963647890 3:147940183-147940205 CAAAAAAAGGAGTTGGGGTGGGG + Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964466343 3:156997414-156997436 CAAAAGAAGCAGCTGGGCTCAGG + Intronic
964576047 3:158169667-158169689 CAAGAGAAGCAGATGGGGTTAGG - Intronic
964881241 3:161425834-161425856 AAAAAGAAGAAGAGGAGGTGAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965969744 3:174540190-174540212 GAAAAAAAGCAGATGAGGCCAGG + Intronic
966323165 3:178723634-178723656 CAAAAGAGGGAGATGAAGAGAGG - Intronic
966560640 3:181316263-181316285 AAAAAGAAGAAGATGAGGGGAGG - Intergenic
966820605 3:183921405-183921427 CAAAAGAAGGAGACGCCGTCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967123375 3:186403595-186403617 AAAAAGAAGTAAATGAAGTCGGG - Intergenic
967197871 3:187044501-187044523 CAAAAGCAGAAGTTGAGGTGGGG - Intronic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
967756689 3:193178221-193178243 GAAAAGAAGAAGAAGAAGTCAGG - Intergenic
969064735 4:4469827-4469849 GGAAAGAAGGTGATGAGGTGAGG + Intronic
969975855 4:11100664-11100686 CAAGGGAAGGAAATGAGGTATGG + Intergenic
970781990 4:19748605-19748627 AAAAAGAAGGAGATGAAGCAAGG - Intergenic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971120532 4:23699550-23699572 AAAAAAAAGGAGATTAGGTAGGG + Intergenic
971611623 4:28732734-28732756 CCTAAGAAGGAGAAGAGGTTTGG - Intergenic
971713286 4:30144784-30144806 CAAAAGATAGAGAAGAGGGCCGG + Intergenic
972494980 4:39626001-39626023 CAGCAGAAGGAGGTGAGGTGCGG + Intronic
972699911 4:41483737-41483759 CCAAGGAAGGAGATGAAGTAGGG - Intronic
973844045 4:54892786-54892808 TAAGACAAGGAGATGTGGTCAGG - Intergenic
974420484 4:61666070-61666092 CAACAGAGGGAAATGAAGTCTGG - Intronic
975051774 4:69874084-69874106 CAAAAGCAGGTGATGAGGCTAGG - Intergenic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
975447083 4:74478485-74478507 CAAAATGATGAGATGATGTCAGG + Intergenic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
977337736 4:95719488-95719510 TGAAAGAAGAAGATGAGCTCAGG - Intergenic
977481435 4:97582118-97582140 CAGAAGTAGGAGATGGGGTTGGG - Intronic
977803028 4:101261169-101261191 AGAAATAAGGAGCTGAGGTCTGG + Intronic
977965333 4:103139858-103139880 CTAAAGAAAGAGATGAGCTAAGG - Exonic
977965669 4:103144400-103144422 CAAAAGAAAGAGATGACCTTAGG - Exonic
978414955 4:108465105-108465127 CAAAAAAAGATGATGAGGCCGGG - Intergenic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
980293421 4:130874632-130874654 CAAAAGAAAGAGATAATGTTAGG + Intergenic
980592531 4:134909763-134909785 CAAAAGAAGGAGAGAAGCTTGGG + Intergenic
982364884 4:154566596-154566618 GAAAGGAAGAAGAGGAGGTCTGG - Exonic
982879682 4:160697079-160697101 CAATAGAAGGAAATGAGATGTGG + Intergenic
983686563 4:170416592-170416614 GAAAAGATGGAGATGTGGCCAGG - Intergenic
984542478 4:181057263-181057285 AAAAAGTAGTAGATGAGCTCAGG - Intergenic
984993167 4:185401586-185401608 CACAAGAAGGCAAAGAGGTCAGG + Intronic
985178833 4:187233855-187233877 CTGAAGAAGGAGATTAGGTCAGG + Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985663218 5:1167770-1167792 CAGAAGAAGCAGGTGTGGTCAGG + Intergenic
985827070 5:2200358-2200380 CAACAGCAGCAGATGAGGTGGGG + Intergenic
986451847 5:7873347-7873369 CAAAACAAGGATATCAAGTCAGG - Intronic
988452338 5:31355966-31355988 CACAAGAAGGACTTGAGGCCAGG - Intergenic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
990791447 5:59484524-59484546 GAAAATAAGGAAATGAGGTCTGG - Intronic
991426171 5:66494522-66494544 AAAAAGAGGGAACTGAGGTCAGG + Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992997494 5:82347480-82347502 CAGTGGAAGGAGCTGAGGTCTGG + Intronic
993551788 5:89282266-89282288 CAAAAGAAGGAGATGTGAAAAGG - Intergenic
993708279 5:91196084-91196106 AAAAAGAAAAAGATGAGGTTTGG + Intergenic
995123822 5:108560431-108560453 CAAAAGAAGGAAGTTAGGTATGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996994417 5:129677830-129677852 CAACAGAACCAGATGTGGTCTGG - Intronic
997356702 5:133267168-133267190 AAAAGGGAGGAGATGGGGTCTGG + Intronic
997767756 5:136522425-136522447 CAAAAGCTGGAGATGAGGAAGGG - Intergenic
998307059 5:141088995-141089017 CAGTAGAAGGAGACTAGGTCTGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998984869 5:147745068-147745090 AAAAAAAAGGAAATAAGGTCTGG + Intronic
999032896 5:148314235-148314257 CATAAGAAGAAAATGAGATCTGG + Intronic
999237581 5:150108353-150108375 CAAAAAAAGGGGCAGAGGTCAGG + Intronic
999716964 5:154369090-154369112 CACAAGAATGAAATGAGGCCAGG + Intronic
1000693969 5:164357565-164357587 CAAAAGAGGAAGTTGAGCTCAGG + Intergenic
1001775227 5:174323915-174323937 GAAAAGAAGGAGATATAGTCTGG - Intergenic
1001818426 5:174690755-174690777 CAAAACAAGGGGATGAGGGTGGG - Intergenic
1001981171 5:176037847-176037869 CAAAAGAGGGTGATGAGAGCCGG + Intergenic
1002236288 5:177806219-177806241 CAAAAGAGGGTGATGAGAGCCGG - Intergenic
1002968132 6:1988418-1988440 CAAAGGGAGGAGATGAGGGTGGG - Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003248242 6:4402126-4402148 CCACAGAAGGAGATGCGCTCTGG - Intergenic
1003464355 6:6364252-6364274 AACATGAAGGAAATGAGGTCAGG + Intergenic
1005097912 6:22138634-22138656 CAGAAGATGGCGCTGAGGTCAGG + Intergenic
1005261994 6:24070969-24070991 AAAAAGAAGAAGAAGAAGTCAGG + Intergenic
1005273463 6:24191074-24191096 CAAAATAAGAAGCTTAGGTCAGG + Intronic
1005763677 6:28989884-28989906 GAAGAGAAGGAGATGAGGGAAGG - Intergenic
1007616562 6:43183188-43183210 TAAAGGTAGGAAATGAGGTCAGG - Intronic
1008079743 6:47181310-47181332 CAAAAGAAAAGGATGAGCTCAGG - Intergenic
1008710607 6:54221631-54221653 CAAAAGCAGGAGATAAGATCTGG + Intronic
1009163586 6:60312506-60312528 CCAAAGCTGGAGATGGGGTCTGG + Intergenic
1009641940 6:66349508-66349530 AAAAAGAAAGATTTGAGGTCTGG + Intergenic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1010493888 6:76509001-76509023 GAACACAAGGTGATGAGGTCAGG - Intergenic
1010756459 6:79671169-79671191 CAAATGACATAGATGAGGTCAGG + Intronic
1010797279 6:80131973-80131995 AAATAAAAGCAGATGAGGTCAGG - Intronic
1011130961 6:84051560-84051582 TAAAAGAAGGAAAAGAGGCCAGG + Intronic
1011813348 6:91158766-91158788 AAAAACAAGGGGAGGAGGTCAGG - Intergenic
1012039086 6:94181981-94182003 CCAAAGAAGCACATGAGGACAGG + Intergenic
1012444247 6:99292048-99292070 CAAAATAAGCAGATGAGGAAGGG + Intronic
1012562191 6:100596911-100596933 AAATAGCAGGAGATGAGGTTGGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1013066799 6:106692126-106692148 CAAAGGAAAGAGATCATGTCAGG - Intergenic
1013715879 6:112960956-112960978 AAATAGAAAGAGATGAGTTCAGG + Intergenic
1013960540 6:115893921-115893943 CAGAGGAAGGAAATGAGGCCAGG + Intergenic
1014144985 6:117987361-117987383 AAAAAGAAGGAGAAGAGGAAGGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1016448451 6:144156357-144156379 GAAAAGAAGGAAATGAGGCCAGG - Intronic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016793916 6:148096951-148096973 CAAATGAAGAAGCTGGGGTCTGG + Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1016962443 6:149687004-149687026 CAGAAGAAGTAGTTGTGGTCTGG - Intronic
1017786076 6:157758280-157758302 AAAAAGAAGCAGATGAGGCCAGG + Intronic
1018425427 6:163675884-163675906 CAAAAGAAGGAAATGAGAAAAGG + Intergenic
1018880855 6:167878735-167878757 GAAAAGGGGCAGATGAGGTCAGG - Intronic
1019002160 6:168763396-168763418 TGTAAGAAGGAGATGAGATCTGG - Intergenic
1019732623 7:2636244-2636266 CATCAGAAGGAAATGAGTTCTGG + Intronic
1019939156 7:4275634-4275656 TAAAAGAATGAGATGGGGCCGGG + Intergenic
1020133640 7:5573989-5574011 AAAAAGAAGCAGATACGGTCAGG - Intergenic
1020133687 7:5574291-5574313 CAAAAGAAGCAGATGTGGCCAGG - Intergenic
1020672032 7:11128179-11128201 CAAAAGATAGCAATGAGGTCTGG - Intronic
1021658483 7:22895204-22895226 CAAAATAAGGAGTTGGGGTTGGG - Intergenic
1022919499 7:34998301-34998323 CAAAAGAGGGGGAGGAGATCAGG + Intronic
1023136078 7:37053535-37053557 CAGAAGAAGGTAATGATGTCTGG - Intronic
1023372951 7:39530173-39530195 GAAAGGAAGGAGAAGAGGTGGGG + Intergenic
1023710797 7:42990541-42990563 CAAAAGAAGAAGTTGGGGTTTGG - Intergenic
1023751651 7:43378822-43378844 CAAAAGAAGGAGGCAATGTCAGG + Intronic
1025189342 7:56884806-56884828 AAAGAGATGGAGATGGGGTCTGG - Intergenic
1025257334 7:57393403-57393425 CAAAAGATGGAGATCTGGCCGGG + Intergenic
1025682598 7:63692111-63692133 AAAGAGATGGAGATGGGGTCTGG + Intergenic
1026220440 7:68391972-68391994 CAAAAGAAAGAGAAAAGGCCAGG + Intergenic
1026605524 7:71812572-71812594 TACAAGAAAGAGATGAGCTCAGG + Intronic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026970858 7:74466658-74466680 CTGGAGAGGGAGATGAGGTCAGG - Intronic
1027323562 7:77030051-77030073 CAAAAGAAGGGTCAGAGGTCAGG - Intergenic
1027677629 7:81179743-81179765 CCAATGATGGAGATGAGGCCTGG + Intronic
1027720581 7:81736564-81736586 CAAATGAAGGAGCTGATGTGAGG + Intronic
1027771798 7:82416360-82416382 AAAAAGAAGGTAATGATGTCTGG + Intronic
1027824116 7:83088835-83088857 GAAAAGATTGAGATGAGGTAAGG - Intronic
1028198405 7:87933954-87933976 CAAAAGAAAGAGATCAGCACTGG - Intergenic
1029306468 7:99623526-99623548 AAAAAGAAGGGGATCAAGTCTGG + Intronic
1029665154 7:101990348-101990370 CAAACAAAAGAGATGGGGTCTGG - Intronic
1031326087 7:120399951-120399973 CAAGAGAATCACATGAGGTCAGG - Intronic
1032063626 7:128746745-128746767 AAAAAGAATGACATGAGGCCGGG - Intronic
1032407904 7:131670574-131670596 TACAAGAAAGAGATGAGTTCAGG + Intergenic
1032502754 7:132412265-132412287 CAACAGATGGAGCTGAGGTCTGG - Intronic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1035445970 7:158943533-158943555 GAAACCTAGGAGATGAGGTCTGG + Intronic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1036474597 8:9081662-9081684 CAAAAGAAGAAGAAGAGGAAAGG - Intronic
1036520486 8:9487111-9487133 GAAAATAAGGAAATGAGGCCAGG + Intergenic
1036555100 8:9852659-9852681 TAAAAGAGTGAGATGAGGCCAGG + Intergenic
1036774629 8:11601875-11601897 AAAAAGAAGAAGAAGAGGTGGGG - Intergenic
1037211897 8:16398880-16398902 CAAAAGAAGGACTTGAGTTCTGG - Intronic
1037453381 8:19039437-19039459 CAGGAGGAGGAGATGAAGTCAGG - Intronic
1037494029 8:19421764-19421786 CAAAAGAAGAAGATGAGTCAAGG - Intronic
1038774575 8:30516799-30516821 CAAGAGAAGGAGTTGAGCCCGGG + Intronic
1039301052 8:36209135-36209157 ACAAAGAGGGAGTTGAGGTCAGG - Intergenic
1041133742 8:54733624-54733646 TAAAGGAAGGAGATCAGCTCTGG + Intergenic
1041243707 8:55871355-55871377 CAATGGAAGGAGATGAGGAGAGG + Intergenic
1043125496 8:76389473-76389495 CAGAAGAAGGTGGTGAGGTGAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044661995 8:94600636-94600658 CAGAAGAAAGCGATGAGGCCGGG + Intergenic
1044710136 8:95049203-95049225 CAAAAAAAGAAGAAGAGTTCAGG - Intronic
1045000574 8:97874709-97874731 AAAAAAAAGTAGAAGAGGTCAGG - Intronic
1045440386 8:102202924-102202946 TACAAGAAAGAGATGAGCTCAGG - Intergenic
1045636370 8:104195806-104195828 AAAAAGATGGAGATAAGGTGGGG - Intronic
1045800325 8:106094162-106094184 CTAAAGAAGAAAATAAGGTCAGG + Intergenic
1046154530 8:110269876-110269898 GAACAGAAGGAGGTGAGGTGAGG + Intergenic
1046584136 8:116130468-116130490 CAAAAGAAACAGATGATGTAGGG + Intergenic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1047495820 8:125407980-125408002 CTGGAGAAGGAGCTGAGGTCTGG - Intergenic
1047886173 8:129252485-129252507 AGAAGGAAGAAGATGAGGTCGGG - Intergenic
1047972882 8:130100622-130100644 CAAAAGAAGAAGTAGAGGCCGGG - Intronic
1049080747 8:140441523-140441545 CTAAAGAAGTAAATTAGGTCAGG + Intronic
1049659793 8:143814843-143814865 GCAAAAAAGGAGAGGAGGTCTGG + Intronic
1051055298 9:12978175-12978197 GAGAAGAGGGAGATGAGGTCAGG - Intergenic
1051115212 9:13686557-13686579 CAAAAAAAGGAGATATGGTTTGG - Intergenic
1051534540 9:18142135-18142157 AAAAAGAAGGGGAAGAGGTCAGG - Intergenic
1052272573 9:26641771-26641793 CAAGGGAAGGAGCTGAGGTTAGG - Intergenic
1052336760 9:27328200-27328222 AAAAAGAAGGAGAGTAGGACAGG + Exonic
1052464965 9:28818679-28818701 TAAAAGAATGAGTTGAGGCCAGG - Intergenic
1052819034 9:33124425-33124447 CAAAAGAGGGAACTGAGGCCTGG - Intronic
1053190538 9:36062771-36062793 CAAAAGTAGGAGATAGGGCCAGG - Intronic
1053435783 9:38073225-38073247 TAAAAGAAGTAGATGAGGCCGGG - Intergenic
1054716874 9:68565270-68565292 CAAAGAAAGGAAATGAGGTAAGG + Intergenic
1054785574 9:69206870-69206892 AAAAATAGGGAGATGAGGCCGGG - Intronic
1055074565 9:72200289-72200311 GAAAAGAAGGAGAGGAGGCTGGG - Intronic
1055855360 9:80679562-80679584 CAGATGAAGAAGCTGAGGTCTGG - Intergenic
1056316032 9:85390888-85390910 CACAAGAAGGAAATGATATCAGG - Intergenic
1056473457 9:86928800-86928822 CAGAAGAATGAAATGAGGTTGGG + Intergenic
1057092259 9:92268970-92268992 CAAGAGAAGAAGGGGAGGTCTGG - Intronic
1057254586 9:93534618-93534640 AAAAAGAAGGAGAAGAGGAGAGG - Intronic
1057321734 9:94019706-94019728 AGAAAGAAGGAGCTGAGGCCTGG - Intergenic
1057378786 9:94549429-94549451 CAACAGATGGATTTGAGGTCAGG - Intergenic
1057438568 9:95064582-95064604 CAAAAGAGGTAGACGAGGCCAGG - Intronic
1057579059 9:96269606-96269628 TAAAAGAAGCAGATTAGGCCGGG + Intronic
1057852142 9:98574028-98574050 GAAAAGAAGGAGATCAGGGAAGG + Intronic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1058882330 9:109296588-109296610 CAGAAGAGGGAGGTGAGGCCAGG + Intronic
1058897268 9:109411251-109411273 CAGATGAAGAAGCTGAGGTCAGG + Intronic
1059103979 9:111495620-111495642 CAAAAGAAGGAGATGATTAGAGG + Intergenic
1059156046 9:111989029-111989051 AAAAATAAGGATATGAGGCCAGG - Intergenic
1059822579 9:117990416-117990438 CAAAAGAAGGTGAGAAGGGCTGG - Intergenic
1061441519 9:130607265-130607287 AAAAAAAAGGAGGTCAGGTCAGG - Intronic
1061675449 9:132213021-132213043 GAAAAGAAGGACTTGAGGCCGGG + Intronic
1203753592 Un_GL000218v1:103104-103126 CAAAAGAAGGCATTCAGGTCAGG + Intergenic
1185587358 X:1249754-1249776 CAACAGAAGGAGCTGTGGTAGGG - Intergenic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1187932368 X:24305219-24305241 AAAAAGAAGAAGAAGAAGTCAGG - Intergenic
1189047155 X:37605572-37605594 CACAGGTAGGACATGAGGTCAGG - Intronic
1189248435 X:39581261-39581283 CAGAAGCAGGTGATGAGGCCAGG + Intergenic
1189512975 X:41682255-41682277 AAAAAGAAGGTGAAGGGGTCAGG + Intronic
1190159259 X:48018386-48018408 AAAAAGAATGAGATCAGGCCAGG + Intronic
1190174972 X:48140615-48140637 AAAAAGAATGAGATCAGGCCAGG + Intergenic
1191587903 X:62848909-62848931 GAAAAGAAAAAGGTGAGGTCAGG + Intergenic
1192339997 X:70256522-70256544 CACAAGAAGGAGATGAATTTGGG + Intergenic
1192345880 X:70304955-70304977 CAATAGAAAGAAATGAGGCCGGG - Intronic
1192896222 X:75445510-75445532 TAAAAGAAACAGATGAGTTCAGG + Intronic
1193255883 X:79348740-79348762 CAAAAGAAGCATGTGATGTCGGG - Intergenic
1193978822 X:88156941-88156963 CAAAAGAAAAGGATGAGCTCAGG + Intergenic
1195006282 X:100688858-100688880 AAAAAGAAGGATATGAGGCCAGG - Intronic
1195097267 X:101515100-101515122 CAGAAGAAAGGGATGAGCTCAGG - Intronic
1198077530 X:133208466-133208488 CAAAAAAAGGAGTTGTGTTCAGG - Intergenic
1198255569 X:134921450-134921472 CAAATGAAGGATCTGAGCTCAGG - Intergenic
1198833106 X:140772038-140772060 TAAAAATAGGAAATGAGGTCAGG - Intergenic
1200134185 X:153866955-153866977 CAAAGGAAGGGGCTGATGTCTGG - Intronic
1201610788 Y:15840658-15840680 TAGAGGAAGGAGTTGAGGTCAGG + Intergenic
1201684123 Y:16682335-16682357 CAAAATAAAGGGATGAGCTCTGG + Intergenic
1201954043 Y:19601384-19601406 AAAAGGCAGGAGAAGAGGTCTGG - Intergenic