ID: 970964505

View in Genome Browser
Species Human (GRCh38)
Location 4:21912951-21912973
Sequence GAGAGTAAACTGAAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970964502_970964505 -4 Left 970964502 4:21912932-21912954 CCCCTCTGAATATCATGTAGAGA 0: 1
1: 0
2: 1
3: 45
4: 411
Right 970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG 0: 1
1: 0
2: 0
3: 19
4: 311
970964504_970964505 -6 Left 970964504 4:21912934-21912956 CCTCTGAATATCATGTAGAGAGT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG 0: 1
1: 0
2: 0
3: 19
4: 311
970964503_970964505 -5 Left 970964503 4:21912933-21912955 CCCTCTGAATATCATGTAGAGAG 0: 1
1: 0
2: 0
3: 8
4: 200
Right 970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG 0: 1
1: 0
2: 0
3: 19
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970964505 Original CRISPR GAGAGTAAACTGAAGAAGAC AGG Intronic
902922553 1:19675474-19675496 GAGAGTTGACTCAAGAACACAGG - Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903847949 1:26289651-26289673 CAGACTCAAGTGAAGAAGACGGG + Intronic
906172260 1:43736481-43736503 GAGAGTAAACTGAACATTTCTGG + Intronic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
907675383 1:56513168-56513190 AAGAGTAACCTGAAGAAAAATGG + Intronic
908018071 1:59867450-59867472 TAGAGGAAAAAGAAGAAGACTGG - Intronic
908368250 1:63450115-63450137 GAAAGTTAACTAAAGAATACAGG + Intronic
909115843 1:71535296-71535318 GAGAGTTCATTGAAAAAGACGGG + Intronic
909473572 1:76056850-76056872 GAGAGTAAAATTATGGAGACAGG - Intergenic
909707777 1:78607839-78607861 GAGGGTGAGCTGAAGAAGAGGGG + Intergenic
909961293 1:81846918-81846940 GTAAGTAAAGTGAAGGAGACAGG + Intronic
910723602 1:90314597-90314619 GAGACAAAACTGAGGAAGGCTGG - Intergenic
910844018 1:91588052-91588074 GAAAGAAAAATGAAGAAAACAGG - Intergenic
910953472 1:92676169-92676191 GAGAGTTAACATAAGAAAACTGG + Intronic
912963108 1:114213544-114213566 GAGGGTGAACAGAAGATGACTGG + Intergenic
913401794 1:118443068-118443090 GAGAGTAAAATGAAAAAATCAGG + Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914799774 1:150952222-150952244 CAGAGTAATCTGAAAAAGGCAGG - Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
916152129 1:161804468-161804490 TTCAGTAAACTGAAGAAGAGAGG + Intronic
917192346 1:172431451-172431473 GAGAGGAAGCTGCAGAAGAAAGG + Intronic
917616643 1:176752642-176752664 AACAGTAAACTGAAGAACAGAGG - Intronic
917716479 1:177743161-177743183 GTGAGGAAACTGAAGCAGAAAGG - Intergenic
918480465 1:184972592-184972614 GAGAGAAAGCTGAACAAGACTGG + Intronic
918496147 1:185139165-185139187 GAGAGTAAACTGAATATTTCAGG + Intronic
919169999 1:193941830-193941852 GAAATTAAAATGAAGAAAACAGG + Intergenic
919523529 1:198619339-198619361 GAGAGAAATGTGAAGAAGGCTGG - Intergenic
919546325 1:198924113-198924135 GCGAGGAAACTGAATAAGAAAGG + Intergenic
919622508 1:199878688-199878710 GAGATTAAAGAGAACAAGACAGG - Intergenic
920144962 1:203852159-203852181 GTGAGGAATCTGAAGAGGACTGG - Exonic
920749781 1:208662819-208662841 GTCAGTAGACAGAAGAAGACAGG - Intergenic
920844970 1:209585968-209585990 GAAAGCAAACTGAAGCAGGCAGG + Intronic
921685120 1:218081199-218081221 GACAGGAAACTGAAGAAAATAGG + Intergenic
921820346 1:219609845-219609867 GTGAGGAATCTGAAGAGGACTGG + Intergenic
923207327 1:231771710-231771732 CAGAGTAGAGTGGAGAAGACCGG - Intronic
924224279 1:241908060-241908082 CAGAGAAACCTGAAGAACACTGG + Intergenic
924381716 1:243471494-243471516 GAGAGGACACAGAAGAGGACTGG - Intronic
1064832752 10:19489315-19489337 AAGAGTTAACTGCAGAAAACGGG + Intronic
1065046967 10:21753804-21753826 AAGCGTAAACTGAAGAGGAAAGG + Intergenic
1066692244 10:38041940-38041962 GGGAGGAAACTTAAGAAGATGGG - Intronic
1068484671 10:57642449-57642471 GTGAGTAAAGTGATGTAGACAGG - Intergenic
1071319141 10:84435431-84435453 GGGAATACACTGAAGGAGACTGG - Intronic
1071700142 10:87922680-87922702 GATTGTAAACTGTAGAAGAAAGG - Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072394356 10:95023472-95023494 GAGAGTGAGCTGAAGCAGAGTGG - Intergenic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1077866216 11:6223742-6223764 GCGAGAAAAGAGAAGAAGACGGG + Exonic
1082061392 11:47863651-47863673 GAAAATAAACAGTAGAAGACTGG - Intergenic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082819582 11:57535760-57535782 GAGAATAAAGTGAAGAAGCATGG - Intergenic
1083980214 11:66161508-66161530 GAAAGGAAACTGAAGTAGAGCGG + Intronic
1084038541 11:66528409-66528431 AAGAGTAAACCTAAGAAGATTGG + Intronic
1086032255 11:82374316-82374338 GAGAGCAATTTGAAGAAGCCAGG + Intergenic
1086616168 11:88823078-88823100 GAGAGAAAACACAAGAAAACTGG - Intronic
1088216001 11:107510531-107510553 GAGAGTATACTCAAGAAGCTTGG + Intronic
1088974157 11:114799931-114799953 GAGAGAAAACGGATGAAGACGGG - Intergenic
1089340186 11:117752071-117752093 CAGAGTATACTGCAGAAGGCAGG + Intronic
1090342723 11:126039790-126039812 GAGGGGAAGCTTAAGAAGACAGG - Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091343121 11:134835348-134835370 GAAAGGAAACAGAAGAAGATGGG - Intergenic
1094059698 12:26300635-26300657 CAGAGAAAGCTGAAGATGACAGG - Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095659313 12:44710828-44710850 GAGAGTAGAATCAAGAAGAAAGG + Intronic
1095703950 12:45217617-45217639 GAGAGAAAACTGAAGCGCACAGG + Intronic
1096454519 12:51774056-51774078 GGGAGTAAAGCGAAGGAGACAGG + Intronic
1098913900 12:76237882-76237904 GAGAGGAATATGAATAAGACTGG - Intergenic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1104356188 12:128089177-128089199 GACAATCAACTGCAGAAGACAGG + Intergenic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1107045015 13:35984724-35984746 GATAGAAAATTGAAGAAGAAGGG - Intronic
1107570787 13:41656096-41656118 GAGAGTAACCCGAAGCAGACTGG + Intronic
1108086364 13:46797246-46797268 GAGACTGAACTGGAGAAGAGCGG - Intergenic
1108421892 13:50259197-50259219 GAGAGAAAACCTAAGAAAACTGG - Intronic
1108461670 13:50673237-50673259 GAGAATAAACTCAAGAGGAATGG - Intronic
1108486898 13:50935871-50935893 GAGAGTATATTGGAGAAGCCAGG + Intronic
1109110427 13:58311590-58311612 GAGAGAAAACAAAAGAGGACAGG - Intergenic
1109258128 13:60109149-60109171 GAGAGTAAACTGGAAAAAACTGG + Intronic
1114290561 14:21284867-21284889 GAGACAAAACTGGAAAAGACTGG + Intergenic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1115785395 14:36820053-36820075 GAGAGGGAACTGATGGAGACTGG + Intronic
1116957839 14:50943202-50943224 GAGAGGAAACTGGAGAAGCCAGG - Intronic
1117814978 14:59588122-59588144 GAGAGGGAACTGAGGAAGCCTGG + Intergenic
1120441284 14:84543767-84543789 GAAAGTAAACACAAGAAAACAGG + Intergenic
1120461315 14:84799977-84799999 GAGAGTGAAGTGGAGAAGCCAGG + Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121542923 14:94741977-94741999 GAGAGGAAAATGAAGGAGAAAGG - Intergenic
1122034569 14:98938031-98938053 GAGAGAAAATGGAAGAAGAAAGG + Intergenic
1122220360 14:100235048-100235070 GAGAGTAAGCAGAAGAATAAAGG - Intergenic
1122280359 14:100618600-100618622 GTGAGAAAAATGAAGAAGTCAGG + Intergenic
1123457163 15:20436694-20436716 GGGAGAAAACTCAAGAAGACTGG + Intergenic
1123660897 15:22563665-22563687 GGGAGAAAACTCAAGAAGACTGG - Intergenic
1124263319 15:28211843-28211865 GGGAGAAAACTCAAGAAGAGTGG + Intronic
1124314698 15:28657903-28657925 GGGAGAAAACTCAAGAAGACTGG - Intergenic
1125073006 15:35578253-35578275 CAGATAAACCTGAAGAAGACTGG - Intergenic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1127089372 15:55451549-55451571 GAGAGCAAAATGAAAAAGAATGG + Intronic
1127179395 15:56399130-56399152 GAGGGTGAACTGAAGCAGAGTGG + Intronic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127943956 15:63730733-63730755 GAGAGTAAATTGCAGATGGCTGG - Intronic
1128689806 15:69715084-69715106 GAAAGAAAACTAAAGAAGAGTGG - Intergenic
1130895285 15:88165529-88165551 GAGAGTAAACTAAAGAAAATTGG + Intronic
1131972670 15:97907729-97907751 GACAGAAAAATGAAGAAGAGAGG - Intergenic
1134754357 16:16653036-16653058 GAGACCACACTGAACAAGACAGG + Intergenic
1134991703 16:18705998-18706020 GAGACCACACTGAACAAGACAGG - Intergenic
1137570400 16:49562485-49562507 GAGTCTATACTGAAGAAGCCAGG + Intronic
1137873737 16:51975280-51975302 GATAGTAAAGTGAAGAAGATAGG - Intergenic
1139016765 16:62698786-62698808 GAGTATGACCTGAAGAAGACTGG + Intergenic
1139417734 16:66828178-66828200 GAGAGTAAATTTAAGAATACTGG + Intronic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140341621 16:74170363-74170385 GAGAGTGAACTGGGGGAGACGGG + Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1142406565 16:89893504-89893526 GATAGGAAACTAAAGCAGACGGG + Intronic
1142665558 17:1461392-1461414 GAGAGGAAAGGGAAGAAGGCTGG - Intronic
1143344670 17:6241033-6241055 GAGAGAAAAATCAAGATGACAGG - Intergenic
1143474938 17:7197044-7197066 GGGAATAAGCTGAGGAAGACAGG + Exonic
1143696286 17:8621935-8621957 GATAGTACAGTGAAGAAGACAGG - Intronic
1144285283 17:13768681-13768703 GAGAGGAATATGAAGCAGACAGG - Intergenic
1144317640 17:14078473-14078495 GAGCAAAAAGTGAAGAAGACTGG - Intronic
1144531509 17:16043827-16043849 TAGATTAAACTGTTGAAGACTGG + Intronic
1144627869 17:16854256-16854278 AAAAGCGAACTGAAGAAGACTGG + Intergenic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1146638482 17:34523214-34523236 GAGAGTAATTTGAAGAGGGCAGG + Intergenic
1147329407 17:39688089-39688111 GAGAGTAGAATAAAGAACACAGG - Exonic
1148535362 17:48434018-48434040 GAGAGGAAACTGCAGAGGGCAGG + Intergenic
1148726242 17:49792637-49792659 GACAGTACACTGAAGAGTACTGG - Intronic
1149190182 17:54051545-54051567 GAGAATAACATGAGGAAGACCGG + Intergenic
1150698348 17:67425419-67425441 GAGAGGAAAAGAAAGAAGACAGG - Intronic
1150934273 17:69618237-69618259 GAAAGAAAACTGAAGGAGAGAGG + Intergenic
1153132189 18:1867220-1867242 TAGAGTAAATAAAAGAAGACAGG + Intergenic
1154123497 18:11670266-11670288 GAGAGTAAGAAGAAAAAGACGGG - Intergenic
1154490102 18:14915200-14915222 GAGAGCAAACAGCAGCAGACAGG + Intergenic
1155647009 18:28091126-28091148 GAAAGTAAACTTAAGAGCACTGG + Intronic
1156068449 18:33174741-33174763 GATAGGAAAATGAAGAAGATAGG - Intronic
1156367683 18:36445037-36445059 TAAGGTAATCTGAAGAAGACAGG + Intronic
1156430524 18:37068615-37068637 GAGAATTTACTGAAGAAGATAGG - Intronic
1156798958 18:41085047-41085069 GAGAATAAACTAAGGAAGAAAGG + Intergenic
1157106845 18:44781838-44781860 AAGTGTAAAATGAAGAAGTCAGG + Intronic
1157144510 18:45148044-45148066 GAGAGTAAACGGGAGCAGAAGGG - Intergenic
1157904996 18:51561892-51561914 GAGAGGCATCTGAAGGAGACTGG - Intergenic
1158027896 18:52924076-52924098 GAAAGGAAACTGAGGAAGTCAGG + Intronic
1158651053 18:59286152-59286174 GATAGTAAAATAAAGAAGATAGG - Intronic
1158796590 18:60853719-60853741 ATGAGGAAACTGAAGAAGAGAGG - Intergenic
1159725889 18:71957829-71957851 GAGATTAAAATGAAGAAGTTGGG + Intergenic
1164864244 19:31590733-31590755 GAGACTAGACAGAGGAAGACAGG - Intergenic
1165723910 19:38099505-38099527 GGGAGTATAATGAAGAAAACAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1168113048 19:54205759-54205781 CATAGTAAACTGCAGATGACAGG - Intronic
924961494 2:38708-38730 GAGAGAACACTCAAGAAGAAAGG + Intergenic
925419001 2:3695623-3695645 GAGATGACACTGGAGAAGACAGG + Intronic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
925541549 2:4972914-4972936 GAGTTTATAATGAAGAAGACTGG - Intergenic
925561122 2:5196822-5196844 GACAATAAACGTAAGAAGACAGG - Intergenic
926286319 2:11491796-11491818 GAGGAGAAACTGAAGAAAACTGG - Intergenic
926493143 2:13550291-13550313 GAGAGTATACAGAATAAGCCTGG - Intergenic
926824084 2:16884827-16884849 GAGAGTAAAAGGAAGAATAAAGG - Intergenic
927512232 2:23651164-23651186 GAGAGTTACATGAAGAAAACAGG - Intronic
928895758 2:36261129-36261151 GAGAGTATTCTGAAGGTGACAGG - Intergenic
930112876 2:47694207-47694229 GCCAGGAAACTGAAGAAGAAGGG + Intergenic
931173667 2:59831207-59831229 AAGAGAAAAGTAAAGAAGACTGG - Intergenic
931782411 2:65590168-65590190 GAAAGTAAAGAGAAGAAGAATGG - Intergenic
932872340 2:75414489-75414511 CATTGTAAACTGACGAAGACTGG - Intergenic
932981044 2:76667465-76667487 CCGAGTAAACTGCAGAATACAGG + Intergenic
933161187 2:79026670-79026692 GAGAGTAAAATGAAGAGTAGGGG - Intronic
935210402 2:100934996-100935018 GAGAGAAGAGGGAAGAAGACGGG - Intronic
936474343 2:112826658-112826680 GAGAGTGAGCTGCCGAAGACTGG + Intergenic
937143840 2:119625640-119625662 GAGAGTATACTGAGAAAGATTGG + Exonic
938194807 2:129318266-129318288 GAATTTAAACTCAAGAAGACAGG + Intergenic
938833202 2:135073685-135073707 GAGAGTAGAATGAGGAGGACAGG - Intronic
938859347 2:135351142-135351164 GATAGAGAATTGAAGAAGACTGG - Intronic
940055857 2:149511899-149511921 GAGCGTGAATTGGAGAAGACAGG + Intergenic
940262504 2:151796313-151796335 GATAGTAAACAGAAGAAAAAAGG - Intronic
942120746 2:172774222-172774244 GGGAATGAACTGAAGAAGAAAGG - Intronic
942311556 2:174661421-174661443 GAGAGTACACTGGACAAGTCCGG - Intronic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
945810461 2:214543673-214543695 GAGAGGAAAATGAAGATGGCTGG + Intronic
946506783 2:220309776-220309798 GAGGGGAAAGTGAAGAAGAGAGG + Intergenic
948162447 2:235836163-235836185 AAGAGTAAACTGAACAGCACAGG + Intronic
948274439 2:236697284-236697306 GAGAGCAAACTGAAGAGGAGAGG + Intergenic
1170051799 20:12154272-12154294 GAGAGGAAAATTAAGAAGATAGG + Intergenic
1170774437 20:19363413-19363435 GATAATGAACTTAAGAAGACGGG - Intronic
1172646058 20:36470321-36470343 GAGAGTAGACTGAGGAAGCCTGG - Intronic
1172732646 20:37100805-37100827 GAAAGGAAAAGGAAGAAGACAGG + Intergenic
1172949789 20:38715569-38715591 ATGAGTAAACTGAAGCAGAGAGG + Intergenic
1174117793 20:48239314-48239336 AAGAGGAAACTAAAGAACACGGG - Intergenic
1174601765 20:51730694-51730716 GAGACTGTACTGAATAAGACAGG + Intronic
1174677589 20:52373298-52373320 GAGAGCAATGTGAAGGAGACAGG - Intergenic
1177318148 21:19487785-19487807 GAAAGTAAACTGACAAAAACCGG + Intergenic
1177503584 21:21991449-21991471 AATAGTAAATTAAAGAAGACAGG + Intergenic
1180324087 22:11352793-11352815 CAGATGTAACTGAAGAAGACAGG - Intergenic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
949786819 3:7751021-7751043 AAGAGAAAACTGAGGAACACTGG + Intergenic
950746054 3:15090112-15090134 GTGAGTAAACTGCAGAAGTAGGG - Intronic
950896501 3:16456404-16456426 GAGAGGAAACTCAAGGAGAATGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
953502046 3:43446023-43446045 GAGAGTAAAGACAAGAAGCCTGG + Intronic
954373116 3:50179814-50179836 GAGAGGAAGCTGGAGAAGAAAGG - Intronic
955057975 3:55473256-55473278 CAGAGTAAACTGTAGAGGACTGG - Intronic
955286634 3:57647817-57647839 CAGAGTAACCTGAATGAGACAGG + Intronic
955286833 3:57649830-57649852 TAGAGTAACCTGAATGAGACAGG - Intronic
955595446 3:60585173-60585195 GAGAGTAAGCTGAAGCTGAGTGG + Intronic
956462065 3:69482509-69482531 GGGAGAAAAATGAAGGAGACAGG + Intronic
956951380 3:74287626-74287648 GAGAGCAGAGTGAAGAAGAGTGG - Intronic
957647723 3:82954561-82954583 GTGAATAAACTGCAGAAGATTGG - Intergenic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
962224696 3:133596245-133596267 GAGGGGAGACTGAAGAAGTCAGG - Intergenic
964998075 3:162912857-162912879 GAGATTATACTGAAGAATAGAGG + Intergenic
965496173 3:169401654-169401676 AAGAATAAGCTGAAGAAGAAAGG + Intronic
967205815 3:187120100-187120122 TAGAGAAGAGTGAAGAAGACAGG + Intergenic
967535441 3:190596684-190596706 TGGAGTAAACTGAATAAGAAGGG + Intronic
967767733 3:193300153-193300175 GAAAGAAAAGTAAAGAAGACAGG - Intronic
969726015 4:8918558-8918580 TAGAGCAAACTGAAATAGACAGG + Intergenic
970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG + Intronic
971967539 4:33579678-33579700 AAAACTAGACTGAAGAAGACAGG + Intergenic
972716734 4:41653918-41653940 GTGATTCAACTGAAGATGACTGG - Intronic
974703996 4:65487854-65487876 GAGAGTCAATTGATCAAGACAGG - Intronic
974764304 4:66322331-66322353 GAGAGGAAAGTGAAGAAAATGGG - Intergenic
975809713 4:78154527-78154549 GAGAGTACAGTGATGAAGACTGG - Intronic
976334914 4:83874268-83874290 GGGAGTAAAATGATGATGACAGG - Intergenic
976698497 4:87943768-87943790 AAGAGTAACCTGAAGAAAAAAGG + Intergenic
976834690 4:89357805-89357827 GAGAGTGAACTGATGGAGAAAGG - Intergenic
977818193 4:101440830-101440852 GAGAGAACATTGAAGAACACAGG + Intronic
981744835 4:148042686-148042708 CAGAGTATAATGCAGAAGACAGG - Intronic
981762698 4:148211070-148211092 CAGAGCAAACTGCTGAAGACAGG + Intronic
982617018 4:157651580-157651602 GAGATTCACCAGAAGAAGACAGG + Intergenic
983970054 4:173860387-173860409 GAGAATGAACAAAAGAAGACAGG - Intergenic
984472125 4:180189679-180189701 GAGAGAAAACAGAAGAAAATAGG + Intergenic
985186922 4:187327562-187327584 GAGTGTAAACTTAGGGAGACAGG - Intergenic
986086522 5:4456934-4456956 AAAAGTCAACTGAAGATGACTGG - Intergenic
986165689 5:5269806-5269828 GAGAGTCAAGTGTAGAAGATAGG - Intronic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986949373 5:13063161-13063183 ATGAGTAAAGTGAAGAAGGCAGG + Intergenic
988395326 5:30690684-30690706 GAGAATAGATTAAAGAAGACCGG - Intergenic
989139080 5:38184584-38184606 GAGTGTTCACTGAAGAAGATTGG - Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990774146 5:59286181-59286203 AAGAGAAATCTGAAGATGACAGG + Intronic
991257840 5:64634654-64634676 GAAAGTAACCTTCAGAAGACTGG - Intergenic
991716594 5:69456644-69456666 GAGAGTAAAGATAAGAATACTGG + Intergenic
991731006 5:69588245-69588267 GAGAGTAAAGATAAGAATACTGG + Intronic
991807439 5:70443406-70443428 GAGAGTAAAGATAAGAATACTGG + Intergenic
991976489 5:72188331-72188353 GAGAGAAAGCTGCAGAAGGCTGG + Intronic
993899966 5:93578686-93578708 GAGAGAGATCTGAAGAAGAGGGG + Intergenic
993943527 5:94091573-94091595 GAGTGGAAACTGAAGCAAACTGG + Intronic
993946131 5:94118657-94118679 AGGACTAAACTGAAGAAGACTGG - Intergenic
994168858 5:96637555-96637577 GACATTAAACAGATGAAGACTGG + Intronic
995436833 5:112145538-112145560 GTGACAAATCTGAAGAAGACAGG - Intronic
996785935 5:127236664-127236686 GACAGTAAGTTTAAGAAGACAGG - Intergenic
997007160 5:129831752-129831774 GTGACTAAAATGAAGAAGGCAGG - Intergenic
997655639 5:135552290-135552312 GAAAATAAACTGAAGGAGAGCGG + Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
1000530725 5:162416552-162416574 GAAATAAAACTGAAGCAGACAGG - Intergenic
1001442749 5:171757751-171757773 GAGGTTAATCTGAAAAAGACTGG + Intergenic
1001691054 5:173632733-173632755 GAGAGGAAAGGGAAGAAGAAAGG - Intergenic
1003434943 6:6079435-6079457 TAGCGTCAACTGAAGAAGAAGGG + Intergenic
1003662675 6:8077604-8077626 GTGAGGAAACTGCAGAAGAAAGG - Intronic
1005486102 6:26301219-26301241 GGGAGAAAACTGAAAAAGATAGG + Intergenic
1006204695 6:32330117-32330139 GAGAGAAAACTGTAGAACTCAGG + Intronic
1006401009 6:33817377-33817399 GAGGGAAACCTGAAAAAGACTGG - Intergenic
1007751053 6:44072426-44072448 GGGAGTGAACTGAAGGGGACTGG - Intergenic
1008608329 6:53162609-53162631 GAGAGGAAACCCAAGAAGGCTGG - Intergenic
1009565291 6:65304717-65304739 GTGAGGAATCTGAAGAGGACTGG - Intronic
1010420173 6:75664678-75664700 GACAGTAAAATTAAAAAGACAGG + Intronic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1014141308 6:117946499-117946521 AATAGTGAACTGAAGAACACTGG - Intronic
1015396008 6:132735606-132735628 GGGTTTAAACTGTAGAAGACAGG - Intergenic
1015531840 6:134228524-134228546 GACTGTAAACTGTAGAAGAAGGG + Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017192315 6:151667556-151667578 AAGATTTAACTCAAGAAGACAGG + Intronic
1017506717 6:155075096-155075118 GAGAGTAACCTGGAGTAGCCAGG - Intronic
1022534726 7:31090242-31090264 GAGAGAAAATTGAATAAGATGGG - Intronic
1023052067 7:36261516-36261538 GAGGGTGGACTGAAAAAGACAGG - Intronic
1023311749 7:38894672-38894694 ACGAGGAAACTGAAGAATACAGG + Intronic
1026511930 7:71034536-71034558 GAGAGCAAAGTGAAGAAGCAGGG - Intergenic
1027382147 7:77622358-77622380 CAGAGTAAAATGAAAAAGATGGG + Intronic
1027775233 7:82456595-82456617 GAGAGTTAAAAGAAGAAGAAGGG - Intergenic
1028745680 7:94323784-94323806 GAGAGAAAACCAAAGAAGTCAGG - Intergenic
1028820401 7:95204364-95204386 TAGAGGAAACTGAAGAATAAAGG + Intronic
1028828619 7:95302889-95302911 GAGAATAAACAGCAGAAGAACGG - Intronic
1029215987 7:98950038-98950060 GAGGGTCAAAAGAAGAAGACAGG - Intronic
1030183526 7:106736137-106736159 GAGAGCAAAATGAAAAAGAATGG - Intergenic
1031888182 7:127262328-127262350 GAGAAGAACCTGAAGAAGAAGGG - Intergenic
1033550669 7:142444905-142444927 GAGAGGAGCCTGAATAAGACAGG - Intergenic
1033561214 7:142533529-142533551 GAGGGGAAACTGAAGAACAGGGG + Intergenic
1034315610 7:150128831-150128853 GAGAGTCAACTGTAAGAGACAGG + Intergenic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1036478340 8:9115156-9115178 GACAATAAACATAAGAAGACTGG + Intronic
1037007925 8:13805430-13805452 GAGAATCGAGTGAAGAAGACAGG + Intergenic
1037067444 8:14599586-14599608 GGGAGAAAACTGAATAAGGCTGG + Intronic
1038828643 8:31033427-31033449 GAGAGTGCACTGAGGAAGAGCGG - Exonic
1039522535 8:38183485-38183507 GAGATTAAATAGAAGAATACAGG - Intronic
1040914518 8:52555419-52555441 GAGAGTAAACTCACAGAGACAGG + Intronic
1041314569 8:56547495-56547517 GGGATTAAAATGAAGAAGACAGG + Intergenic
1042191944 8:66195924-66195946 CAGACTATACTGAAGGAGACAGG + Intergenic
1042626193 8:70760186-70760208 ACGAGTAAACTGAATAAGAATGG - Intronic
1042927889 8:73985173-73985195 CAGAGTAATCTCAGGAAGACTGG + Intergenic
1043216198 8:77592238-77592260 GAGAGCAAAGTGAAGAAAATGGG + Intergenic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045187210 8:99851391-99851413 GAGAGTAAACCTAAAAAGAAAGG + Intronic
1046159661 8:110343854-110343876 TAGAGAAAAATGAATAAGACAGG - Intergenic
1046916825 8:119687028-119687050 CAGAGTCAACTGAACAACACAGG - Intergenic
1047333030 8:123909526-123909548 GAGCATAGACTGAAGGAGACTGG + Intronic
1048566997 8:135611531-135611553 GAGAGAGGACTTAAGAAGACTGG - Intronic
1048747198 8:137627177-137627199 AATAGTAAAATGAAGAAGATGGG + Intergenic
1051880381 9:21833917-21833939 GAGAGTGAAAGGAAGAACACTGG - Intronic
1052151787 9:25126203-25126225 GGGAGTACCCTGATGAAGACGGG - Intergenic
1052156604 9:25200651-25200673 GAGGGTAAAATGAAGAAGCCAGG + Intergenic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1055268077 9:74521687-74521709 AGGAGTAAACTGTAGAAGCCTGG - Intronic
1056265464 9:84892575-84892597 CAGAATAAGCTGAAGAAAACAGG + Intronic
1057464824 9:95303464-95303486 CAGCCTAAACTGACGAAGACAGG - Intronic
1058561490 9:106233400-106233422 GAGAGGAAAAGGAAGAAGAAAGG - Intergenic
1059941154 9:119361157-119361179 GAGAATAGACTGAATGAGACTGG - Intronic
1060677049 9:125524751-125524773 GGGAGTCAGCTGAAGGAGACAGG - Intronic
1062014569 9:134284699-134284721 GAAAGTGAAGTGAAGGAGACAGG - Intergenic
1186299586 X:8185295-8185317 AAGAGAAAGCTGAAGAAGATAGG + Intergenic
1189108875 X:38266259-38266281 GTGAGTAAAATGAAGAAAATGGG - Intronic
1190755137 X:53394903-53394925 GAGAGTCAAGTGGAGCAGACTGG + Intronic
1192125859 X:68499934-68499956 GAGAGTATAGTGAAGATGGCCGG - Intronic
1192365131 X:70465466-70465488 GAAAGTAGACTGAACAGGACAGG - Intronic
1192446239 X:71213632-71213654 GAGAATAAACTGAAGTAATCAGG - Intergenic
1194285774 X:92008170-92008192 GACAGAAAACTGAAGAAACCTGG - Intronic
1194376413 X:93138810-93138832 CAGACCAAACTGAATAAGACAGG + Intergenic
1194849978 X:98858062-98858084 GAGAGTAGAATAAAGAGGACAGG + Intergenic
1195853780 X:109309388-109309410 GAGTGTAGACTGAAGATGATTGG + Intergenic
1195939813 X:110158730-110158752 GAGAGGAAAGTGAAGAGGCCTGG + Intronic
1199115646 X:143988935-143988957 TATATTTAACTGAAGAAGACAGG - Intergenic
1199917775 X:152362769-152362791 GAGAGTAAAGGGTAGAAAACTGG + Intronic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic
1200603332 Y:5232709-5232731 GACAGAAAACTGAAGAAACCTGG - Intronic
1201923937 Y:19264724-19264746 GAGAGTAGAATGAGGAGGACAGG - Intergenic