ID: 970965757

View in Genome Browser
Species Human (GRCh38)
Location 4:21925887-21925909
Sequence TGGAGCTGGAAGACCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970965757 Original CRISPR TGGAGCTGGAAGACCTAGGT TGG Intronic
902246447 1:15124139-15124161 TGGAGCTGAAAGACCTGGTGGGG + Intergenic
903669767 1:25028483-25028505 GGGAGCTGGGAGACCTAAGAGGG + Intergenic
904700059 1:32352501-32352523 AGGGGCTGGAAGCCCTGGGTGGG - Intronic
905794586 1:40808479-40808501 TGGAGCTGGGAGAGGAAGGTGGG - Intronic
906029238 1:42704466-42704488 TTGCACTGGAAGACCTAGGGCGG + Intergenic
906843720 1:49167506-49167528 TAGAGCTCAAAGACCTAGGCAGG - Intronic
907115869 1:51967966-51967988 TTGACCTGGAATGCCTAGGTGGG + Intronic
908304680 1:62800251-62800273 TGGATCTAGAAGACCAAGCTTGG + Intronic
916637414 1:166687890-166687912 TGGAGATGGAAGAACAAGGATGG + Intergenic
916864846 1:168845428-168845450 TGCAGCTGGGAGATCTAGTTTGG - Intergenic
917321187 1:173783457-173783479 TGGAGCTGTGAGACATATGTAGG - Intronic
922571544 1:226637430-226637452 TGGAGCTGGAAGGACAAGGGAGG + Intronic
922678530 1:227569796-227569818 TAGAACTGGAAGTCCTACGTAGG - Intronic
922981074 1:229827407-229827429 TGGATCTGGGAGAAGTAGGTTGG - Intergenic
923348611 1:233081507-233081529 TGGAGCTGTAAGAACCAGGCCGG + Intronic
1066443865 10:35464159-35464181 GGGAGCTGGAAGACCCAGTTCGG - Intronic
1066492364 10:35906191-35906213 TGGACCTAGAAGACCCAGGATGG - Intergenic
1069584113 10:69585839-69585861 TGGAGCTGGGATGCCTAGGAAGG - Intergenic
1070174298 10:73957167-73957189 TGGAGGTGGAGGAACTAGGAGGG - Intergenic
1072026681 10:91467077-91467099 GGGAGCTGGGAAACCTGGGTGGG + Intronic
1072896115 10:99368235-99368257 GGGAGCTGGGAGAGCTTGGTGGG + Intronic
1074937927 10:118204568-118204590 AGGAGCAGAAAGATCTAGGTGGG - Intergenic
1075059689 10:119247115-119247137 TGGAGTTGGACGCCCTAGGACGG - Intronic
1077074108 11:692289-692311 TGGAGCTGCAGGACCTATCTGGG - Intronic
1078085204 11:8229740-8229762 TGGAGCTTCAAGACCTGGGTTGG - Intronic
1081540880 11:44033742-44033764 TGAAGCAGGAAGACCTTGTTTGG + Intergenic
1084773063 11:71356898-71356920 TGGAGCTGGAAGAGGCAGGGAGG + Intergenic
1085213894 11:74810393-74810415 TGGACCTGAAAGACCTATGTTGG + Intronic
1087177121 11:95106204-95106226 TGGATCTGGAAGACAAAGGATGG + Intronic
1089344988 11:117785356-117785378 CTGAGCTGGAAGACCTGGATAGG + Intronic
1090285660 11:125496686-125496708 TGGAGCTGGGAGACGTCGCTGGG - Exonic
1091744280 12:2981331-2981353 AGGAGCTGGAAGACAAAGGGAGG - Intronic
1091813109 12:3416122-3416144 TGGAGCGAGGAGACCTAGGCAGG - Intronic
1092776926 12:11951953-11951975 TGTTTTTGGAAGACCTAGGTGGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094339100 12:29390290-29390312 TGGAGGTGGAAGACCTGAGAAGG + Intergenic
1095900349 12:47321414-47321436 TGGGGCTGGCAGACATTGGTTGG - Intergenic
1096633810 12:52946015-52946037 TGGTGCTGGAAGCCCGAGGTCGG + Intronic
1096669726 12:53191462-53191484 TGGGTCTGTAAGACCTTGGTAGG - Exonic
1096961551 12:55583443-55583465 TAGAGGTGGATGACCTAGGTGGG - Intergenic
1097635805 12:62120785-62120807 TGGAAATGGAAGGCCTAGATGGG - Intronic
1098146048 12:67498953-67498975 TGGAGCTGGTAGCCTGAGGTAGG + Intergenic
1100923278 12:99514631-99514653 TGGTGCCAGAAGACCAAGGTTGG - Intronic
1102296918 12:111744354-111744376 GGGAGCAGGCAGACCTAAGTTGG + Intronic
1102602036 12:114038520-114038542 TGGAGTTGGGAGGCCGAGGTGGG - Intergenic
1103236580 12:119378002-119378024 TGGAGCTGGAAGTCCCACTTGGG - Intronic
1103432676 12:120902634-120902656 TGGAGTTGGAAGACCTATTTCGG - Intronic
1105534046 13:21247648-21247670 TGGAGCTGGGGGACCTGGGTGGG + Intergenic
1110009336 13:70312289-70312311 TGGATATGGATGAACTAGGTGGG - Intergenic
1112412605 13:99177174-99177196 TAGAGCTGGAGGACATGGGTGGG - Intergenic
1115779756 14:36756271-36756293 TGGAGCTGGAAGACGATGTTCGG + Intronic
1115857351 14:37644845-37644867 TAGAGTTAGATGACCTAGGTTGG + Intronic
1116122887 14:40743079-40743101 AGGAGCTAGAAAACCTAGGTAGG + Intergenic
1116391596 14:44398049-44398071 TAGAACTGGAAGTCCTAAGTAGG + Intergenic
1117268329 14:54114384-54114406 TGGAGCTGGAATTCCTGGGAAGG - Intergenic
1119944988 14:78684151-78684173 TGGAGTTGAAAGACCTTGGAAGG + Intronic
1120038348 14:79724011-79724033 TAAACCTGGAAGACCTAGCTTGG - Intronic
1120647312 14:87089440-87089462 TGGAGCCAGAATACCTGGGTTGG - Intergenic
1121976988 14:98414095-98414117 TTGAGCTGGAAATCCTAGGTTGG - Intergenic
1126865917 15:52936576-52936598 TTGAGCTGGAAGACCTCTGTTGG + Intergenic
1129656046 15:77526464-77526486 TGGAGCTTTGAGTCCTAGGTGGG + Intergenic
1129657017 15:77531116-77531138 GGGCGTTGGAAGACCTAGGTTGG + Intergenic
1129772620 15:78212562-78212584 TGGAGCTGGCAGACCTGAGCAGG + Intronic
1129892113 15:79078250-79078272 GGGAGCTGGAGGATCTGGGTGGG - Intronic
1130110141 15:80957386-80957408 TTTAGCTGGGAAACCTAGGTTGG - Intronic
1133125470 16:3643163-3643185 TGGGGCTGGGAGACCAAGATAGG + Intronic
1136064022 16:27746780-27746802 TGGAGCTGAAAGATCATGGTGGG + Intronic
1137554430 16:49461677-49461699 AGGACCTGGAAGACACAGGTGGG + Intergenic
1137563786 16:49520744-49520766 TGGGGCTGGAAGGCCCTGGTTGG - Intronic
1138336028 16:56253323-56253345 TGGAGTCAGAAGACCTGGGTTGG + Intronic
1140424454 16:74849135-74849157 AGCAGCAGGAAGACCAAGGTTGG - Intergenic
1141768070 16:86071756-86071778 TGGAGCTGGAAGAGGGAGGAAGG - Intergenic
1142213796 16:88821235-88821257 TGGAGCTGGAAGAGGCAGGAAGG - Intronic
1142491985 17:285301-285323 TGGGGATGGCAGACCTGGGTGGG + Intronic
1143105033 17:4525277-4525299 AGGAGCTGGAAGCCCTGGGCTGG - Intronic
1143362274 17:6381926-6381948 TGGATCTGCAAGCCCTCGGTAGG - Intergenic
1143406850 17:6683498-6683520 TGGAGTTGGAAGATCTGGGTTGG - Intergenic
1143407030 17:6684421-6684443 TGGAGTTGGAAGCTCTTGGTTGG + Intergenic
1144051320 17:11499441-11499463 TTGAGATGGGAGACTTAGGTGGG - Intronic
1145029767 17:19495586-19495608 TGGGCCTGGGAGACCTAGGCAGG - Intronic
1149628198 17:58095423-58095445 CGTAGCTGGAAGACAGAGGTGGG - Exonic
1152214948 17:79026687-79026709 TGGTGCAGGAAGCCCTAGGTGGG + Intronic
1153819175 18:8818243-8818265 TGGAGTTAGAAGACCTGAGTTGG - Intronic
1155381932 18:25232244-25232266 TGCAGGTGAAATACCTAGGTAGG - Intronic
1155495810 18:26440515-26440537 CGAAGCTGGAAGACCGTGGTGGG + Intergenic
1156092511 18:33488557-33488579 TGAAGCTGTCAGATCTAGGTGGG - Intergenic
1160158830 18:76455508-76455530 GGGAGCAGGGAGGCCTAGGTGGG - Intronic
1160235021 18:77078865-77078887 TGGAGCTGGGAGCCCCAGGCGGG + Intronic
1160443576 18:78911532-78911554 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1160443606 18:78911615-78911637 TGGAGCTGGAGGACCTGGGGTGG - Intergenic
1160515584 18:79477750-79477772 GGGGGCTGGAAGTCCGAGGTTGG + Intronic
1161424930 19:4198267-4198289 TGGAATGGGAAGACCCAGGTAGG - Intronic
1161898179 19:7098347-7098369 TGGGGCTGGAAGATCTAAGGTGG - Intergenic
1163202001 19:15776336-15776358 AGGAGCTGGAAGCCCTTGGATGG + Intergenic
1163690765 19:18737055-18737077 TGGAGCAGGAGCCCCTAGGTAGG - Intronic
1164421199 19:28094480-28094502 TGTTGCAGGAGGACCTAGGTAGG - Intergenic
1164741150 19:30576392-30576414 TGGAGAAGGAGGACCCAGGTGGG - Intronic
1165105910 19:33469618-33469640 TGGAGCTGGGATCCCCAGGTGGG - Intronic
1168582417 19:57566589-57566611 TGGATCTGGAAGAGCTAGTTGGG + Intergenic
925290253 2:2743338-2743360 TGGAGCTGGCTGGCCTAGGATGG + Intergenic
925986467 2:9219318-9219340 TGGAGCAGAAAGACCTAGCCAGG + Intronic
926811452 2:16758419-16758441 TGGATCTGGAAGGACTAGTTGGG + Intergenic
926936898 2:18095169-18095191 TGGCACTGGAAGCCCTAGGTTGG + Intronic
928334469 2:30384600-30384622 AGGAGCTGGAGGGCCTAGATAGG + Intergenic
928854522 2:35788597-35788619 TTGAGCTGGAGCACCCAGGTGGG - Intergenic
928896473 2:36270860-36270882 TGGAACAGGAACTCCTAGGTTGG - Intergenic
929940921 2:46333472-46333494 TGGAGGTGGCAGGCCTATGTTGG + Intronic
932165990 2:69507565-69507587 TGGTGGTTGCAGACCTAGGTAGG + Exonic
932172173 2:69567066-69567088 TGGAGGTGTATGAGCTAGGTTGG - Intronic
932955055 2:76342250-76342272 GAGAGCTGGATGACCTTGGTGGG - Intergenic
934025687 2:88000022-88000044 TGGAGCTGGAATAAGGAGGTGGG - Intergenic
935031901 2:99330644-99330666 TAGAGCTGGCACACTTAGGTAGG - Intronic
938588972 2:132719199-132719221 TGGAGAAGCAAGACCGAGGTGGG + Intronic
939125922 2:138177333-138177355 TGGAGTTAAAAGACCTGGGTTGG - Intergenic
942581618 2:177425296-177425318 TGGTGCTGGGAGAACTGGGTAGG - Intronic
942617428 2:177808490-177808512 TGGAGGAGGTAGACCTAGTTTGG - Intronic
946169601 2:217886815-217886837 TGCTGCTGGGAGCCCTAGGTAGG + Intronic
946761948 2:223003374-223003396 TGGAGCTGCAAGACTTGGATTGG + Intergenic
946960500 2:224979925-224979947 TGGAGCCAGAACACCTAGGTTGG - Intronic
947742000 2:232488870-232488892 TGGAGCCGGCAGACCTGGGAGGG - Intergenic
948922125 2:241070756-241070778 TGAACTTGGAAGACCTAAGTGGG - Intronic
1168763362 20:365016-365038 TGGGGCAGGAAGAACTTGGTAGG + Intronic
1169422416 20:5471131-5471153 GGCAGCTGGAAGACCCAGGTGGG + Intergenic
1169469422 20:5871396-5871418 GGAATTTGGAAGACCTAGGTTGG + Intergenic
1170827197 20:19806941-19806963 GGGATCTGGCAGATCTAGGTTGG + Intergenic
1172581130 20:36049915-36049937 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
1173828336 20:46061895-46061917 TGAAGCTGGAAAGCCTTGGTAGG + Exonic
1174061097 20:47833640-47833662 TGGAGCTGGAAGACCCCGGGAGG + Intergenic
1174061107 20:47833694-47833716 TGGAGCTGGAAGACCGCGGGAGG + Intergenic
1174070669 20:47897005-47897027 TGGAGCTGGAAGACCCCGGGAGG - Intergenic
1174070679 20:47897059-47897081 TGGAGCTGGAAGACCCCGGGAGG - Intergenic
1174100420 20:48122670-48122692 TGGAGCTGGAAGACCCCGGGAGG + Intergenic
1174100430 20:48122724-48122746 TGGAGCTGGAAGACCCCGGGAGG + Intergenic
1174153380 20:48501597-48501619 TGGAGCTGGAAGACCCCGGGAGG + Intergenic
1174580633 20:51569109-51569131 AGGAGCAGGAACACCAAGGTGGG - Intergenic
1174794400 20:53510344-53510366 AGGGGCTGGAAGACCTAGAGGGG - Intergenic
1175238147 20:57526776-57526798 GGGCGCTGGGAGACCTAGGCGGG + Intergenic
1175777769 20:61663834-61663856 GGGAGCTGGAAGACCCAGCGTGG - Intronic
1175941769 20:62540639-62540661 TGGAGCTGGCAGCCCCAGGCAGG - Intergenic
1176090608 20:63316713-63316735 TGGAGCTGGAAGCCCAGGCTGGG + Intronic
1179531746 21:42024348-42024370 TGGGGCTGGAAGACGACGGTGGG - Intergenic
1179531751 21:42024367-42024389 TGGGGCTGGAAGACGATGGTGGG - Intergenic
1179595347 21:42439299-42439321 TGAAGCTGCAAGACTGAGGTGGG - Intronic
1179969669 21:44827730-44827752 TGGAGATGGAAGACCTCTGACGG - Intergenic
1180107843 21:45631552-45631574 GGGAGCTGGAAGACACAGGGAGG + Intergenic
1181573612 22:23780800-23780822 TGGAGCTGGATGTCCTGGGCAGG + Intronic
1182884325 22:33760445-33760467 TGGAGCTGTCAGACCTGGGCTGG - Intronic
949159040 3:858861-858883 TGGAGCTTGGAGACCCAGGCAGG - Intergenic
950541016 3:13613021-13613043 TGGAGCTAGATGACCTAGGATGG + Intronic
952621953 3:35355410-35355432 TGATGCTGGAAGAACTGGGTAGG + Intergenic
953040726 3:39252889-39252911 TGGACCTGGAAGGCCTGGGGAGG + Intergenic
954579564 3:51695930-51695952 TGCATGTGGAAGACCCAGGTGGG + Intronic
954796718 3:53165198-53165220 AGGAGCTGGGAGCCCCAGGTAGG + Intronic
956538695 3:70309174-70309196 TGGACCTCAAAGACCGAGGTTGG + Intergenic
960582650 3:119294242-119294264 TGGAGCTAGAGGAAGTAGGTGGG - Intergenic
961398514 3:126616188-126616210 AGGAGCTGGAATACTTTGGTGGG + Intronic
961543715 3:127617849-127617871 TGGAAGAGGAAGACATAGGTGGG - Intronic
962859503 3:139386499-139386521 TGGAGCTGGGAGACCGAGGTGGG - Intronic
966696853 3:182798775-182798797 TGGATCTTGAAGACTTAGTTTGG + Intronic
967060460 3:185867869-185867891 TGAACCTGGAAGACAGAGGTTGG - Intergenic
968949144 4:3681418-3681440 GGGAGCTGGAAGACGCAGGATGG + Intergenic
969368786 4:6717167-6717189 TAGAGCTGGAAGACACAGGCTGG - Exonic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
975061765 4:70011871-70011893 TGGTACTGGAAGTCCTAGCTAGG - Intergenic
976651356 4:87438355-87438377 TGAAAATGGAAGACCGAGGTAGG + Exonic
976718852 4:88151115-88151137 TGGGGCTAGAAGACATAGGGAGG + Intronic
976979805 4:91213379-91213401 TGAAGCTGGGAGACCTATTTTGG - Intronic
978389644 4:108212006-108212028 TGGAGGCTGAAGACCAAGGTGGG - Intergenic
981136991 4:141221206-141221228 TGGAGCTGGAGGACCCAGTGGGG - Intronic
985988009 5:3533546-3533568 AGGAGCAGGAAGACTTGGGTGGG - Intergenic
987295295 5:16545165-16545187 TGGAGCTGGAAGAGCTTGTAGGG - Intronic
987989235 5:25189984-25190006 TGGAGCTGGAAGACCTGAGAAGG - Intergenic
988065377 5:26224877-26224899 TGGAGCTTGGAGACCCAGGGAGG - Intergenic
988406754 5:30833851-30833873 TGGTGCTGGGAAACCTAGCTAGG + Intergenic
990519109 5:56560622-56560644 TGGAGCTGGAATATCTGAGTTGG - Intronic
999122405 5:149219351-149219373 TGGAGCAGGAATTCCTATGTTGG + Intronic
999492380 5:152063901-152063923 AGGAGACTGAAGACCTAGGTGGG + Intergenic
1000242593 5:159422526-159422548 TGGAGCTTGAACAACTAGGTCGG + Intergenic
1001062755 5:168507666-168507688 TGGAGCTCAAAGACCTTGTTGGG + Intronic
1001466882 5:171975268-171975290 TGGAGCTGGGAGAACAAGGAAGG + Intronic
1004160480 6:13208537-13208559 TGGAGAGGGAAGACCCAGGCTGG - Intronic
1004437968 6:15615335-15615357 TGCATCTGGAAGACTTATGTGGG - Exonic
1005512482 6:26522725-26522747 TGGAGCTCGAAGACCTGAGAAGG + Intergenic
1008069025 6:47080465-47080487 TGGAGCTGAAAGTCCAAGATTGG + Intergenic
1009878357 6:69534510-69534532 TGGTGGTGGAAGACACAGGTAGG - Intergenic
1012582437 6:100884973-100884995 TTGAGCTGTAAGAAATAGGTTGG - Intergenic
1012973905 6:105759157-105759179 TGGACCTGGAAGAGGAAGGTGGG - Intergenic
1014951826 6:127564984-127565006 TGAAGCTGGATGGCCTAGGATGG + Intronic
1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG + Intronic
1015806314 6:137112549-137112571 TGGAGCTGGAAGACTCCGGGAGG - Intergenic
1018055411 6:160048015-160048037 TGGGGCTGCAGGACCAAGGTGGG + Intronic
1018060236 6:160084421-160084443 TGGAGCTGGAAGAACCTGGGCGG + Intronic
1018079994 6:160251029-160251051 TGGTGATGTAAGACCTAGTTAGG - Intronic
1018746339 6:166765018-166765040 TGGAGCTGAGAGACCCAGGCGGG - Intronic
1018995768 6:168709516-168709538 TGGAACTGGGAGACCTGGCTAGG + Intergenic
1020131796 7:5562960-5562982 TGATGCTGGAAGACTTAGGGTGG + Intronic
1020279073 7:6641201-6641223 TCGAGCTGGATGAGCTAGGGTGG + Intronic
1021688139 7:23206924-23206946 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1021885263 7:25131481-25131503 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1025233644 7:57219298-57219320 TGGAGCTGGAAGACCCCGGAAGG - Intergenic
1026211625 7:68311084-68311106 TGGAACTGGAAGACCCACTTAGG - Intergenic
1026528559 7:71176805-71176827 TGGAGCTGGAGCAGCTAGGGAGG + Intronic
1028305873 7:89263796-89263818 TGGAGCTGGAAGAGGCAGGGAGG + Intronic
1030724606 7:112911365-112911387 TGGAGCTGGATGACCTCTTTAGG - Intronic
1030853612 7:114522432-114522454 AGTAGCTGGAAGACCAAGGAAGG - Intronic
1033604311 7:142914788-142914810 TGGAGCTGGTAGAACTATGGGGG - Intronic
1036592875 8:10184822-10184844 TGGAGTGGGAAGACCTAGGTAGG - Intronic
1037815958 8:22111985-22112007 AGGAGCAGGAAGGCCTGGGTAGG + Intergenic
1037992039 8:23328087-23328109 AGGAGCTGGGAGACCTACGGGGG + Intronic
1038465336 8:27757318-27757340 GAGAGCTGGAAGAGTTAGGTGGG + Intronic
1039271927 8:35891612-35891634 TGGAAATGGAAGACCTGGCTGGG - Intergenic
1039391827 8:37187370-37187392 AGGAGCTGGAAGGCACAGGTCGG - Intergenic
1040698000 8:50025599-50025621 TGTAGTTGGAAAACCTATGTCGG + Intronic
1044145923 8:88713697-88713719 TGGAGCTGTAAGACACAAGTGGG - Intergenic
1044661344 8:94594111-94594133 TCGAGGTGGACGACCAAGGTGGG - Intergenic
1044749496 8:95402453-95402475 TGGAGCGGGGAGACCCTGGTGGG - Intergenic
1045030407 8:98129766-98129788 TAGAGCTAGGAGACCTAGGAAGG - Intronic
1045217401 8:100162026-100162048 TGGTCCAGGAACACCTAGGTGGG + Intronic
1046267312 8:111847363-111847385 TGGAACTGGAAGACTTTGGAGGG - Intergenic
1049708496 8:144053444-144053466 TGGATCTGGGAAACCTGGGTTGG - Intronic
1050739193 9:8800926-8800948 AGGAGCTGGGAAACCTAGGCAGG + Intronic
1051014243 9:12456473-12456495 TGGAGCTGGATGACTTAAGGAGG - Intergenic
1053487585 9:38471565-38471587 GGGAGCTGGAAGTCCAGGGTTGG - Intergenic
1055607843 9:77989595-77989617 TGGAGCTGGAAGCCCTGTGGCGG + Intronic
1055681963 9:78724666-78724688 TGGTGGTGGAAGACCCATGTGGG - Intergenic
1056713348 9:89009226-89009248 TGGAGCTGACAGTTCTAGGTTGG + Intergenic
1056798764 9:89676868-89676890 TGGAGCTGGAAGCCTAAGATAGG + Intergenic
1058349166 9:104000258-104000280 TGGAGCTGGAAGACCTGAGAAGG + Intergenic
1060474026 9:123971605-123971627 TGGAGCTGGAATACCAAGGAGGG + Intergenic
1061415258 9:130444118-130444140 TGGAGCCGGCAGACCAAGCTGGG + Intergenic
1062219359 9:135406173-135406195 TGGAGCTGGAGGAAGCAGGTAGG + Intergenic
1186272123 X:7900267-7900289 TGGAACTGAAGGAACTAGGTAGG - Exonic
1186762176 X:12734599-12734621 TGGAGAGGGAAGTCCTAGGATGG - Intergenic
1187289379 X:17938272-17938294 TGGAACCAGAAGACCTGGGTAGG + Intergenic
1188732112 X:33662181-33662203 TAGTGCTGGAAGCCCTAGTTAGG + Intergenic
1191183595 X:57587217-57587239 TGGAGCAGGAAGTCCTGGGTAGG + Intergenic
1192439654 X:71165268-71165290 TGGTGAGGGAAGACTTAGGTGGG + Intronic
1195162558 X:102184900-102184922 GGGAGCTGGCAGAACTGGGTTGG + Intergenic
1195282336 X:103348331-103348353 TGGAGCTGGAAGACGCTGGAAGG - Intergenic
1195630440 X:107050349-107050371 AGGAGTGGGAAGAACTAGGTTGG - Intergenic
1196364634 X:114910868-114910890 GGGAGTTGTAAGACCTAGTTTGG - Intergenic
1196823210 X:119720306-119720328 TGGGGCTGGAAGAATTAGGAAGG + Intergenic
1198299253 X:135318339-135318361 TGGAGCTGGAAGAGGAAAGTTGG - Intronic
1200141865 X:153906497-153906519 TGGAGGTGGAGGATCTAGGTTGG - Intronic
1200226824 X:154422138-154422160 TGGAGCTGGGGGTCCTGGGTGGG + Intergenic
1200236617 X:154470787-154470809 TGGAGCTGGACTGCCTGGGTGGG + Intronic