ID: 970967872

View in Genome Browser
Species Human (GRCh38)
Location 4:21948843-21948865
Sequence CCGCGCGCCCCCGCCGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970967872_970967890 30 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967890 4:21948896-21948918 TTCGCGCCGGCGGCTGGAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
970967872_970967886 17 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967886 4:21948883-21948905 AGGCGCCGGCAGCTTCGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 78
970967872_970967887 20 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967887 4:21948886-21948908 CGCCGGCAGCTTCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 77
970967872_970967889 24 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967889 4:21948890-21948912 GGCAGCTTCGCGCCGGCGGCTGG 0: 1
1: 0
2: 3
3: 18
4: 118
970967872_970967882 -9 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967882 4:21948857-21948879 GGCGCGCGGGGTGGCGGGGGAGG 0: 1
1: 1
2: 15
3: 220
4: 2108
970967872_970967883 -3 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967883 4:21948863-21948885 CGGGGTGGCGGGGGAGGCCGAGG 0: 1
1: 0
2: 17
3: 189
4: 1580
970967872_970967884 3 Left 970967872 4:21948843-21948865 CCCTTGGCGGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 21
4: 159
Right 970967884 4:21948869-21948891 GGCGGGGGAGGCCGAGGCGCCGG 0: 1
1: 2
2: 19
3: 131
4: 1226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970967872 Original CRISPR CCGCGCGCCCCCGCCGCCAA GGG (reversed) Intergenic
901057401 1:6455100-6455122 CCCAGCGCCGCCGCCGCCCACGG + Intronic
901676572 1:10889013-10889035 CCGCCCGCCCCGGCCGCCCAGGG - Intergenic
901726069 1:11243127-11243149 CCGAGCGGCCCTGCCCCCAAAGG - Exonic
902476958 1:16693379-16693401 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903468429 1:23568312-23568334 CCGCGCCCCTCCCCCGCCAGTGG - Intergenic
903511839 1:23881643-23881665 CCGCCCGCCTCGGCCTCCAAAGG - Intronic
904618181 1:31761013-31761035 CCGCGCGGCACCGCCCCCAGGGG - Intronic
914869037 1:151458574-151458596 CCGCGCACCCCCACCCCCAGGGG + Intronic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1062843805 10:689765-689787 TCGCGCGCCCCCGCGCCCCACGG + Intergenic
1063115118 10:3067473-3067495 CCGCCCGGCCCCAGCGCCAATGG - Intronic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1076993819 11:289056-289078 GCGACCGCCCCCGCCGCCCAGGG + Intergenic
1076999596 11:315989-316011 CCGCGCACCCCCGACGCCCGTGG - Intergenic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077154311 11:1084661-1084683 GCGCGCGCCTGCACCGCCAAGGG + Intergenic
1081970953 11:47198355-47198377 CCGCCCGCCCCGGCCTCCCAAGG - Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1088053863 11:105552256-105552278 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1089046387 11:115504581-115504603 CGGCGCGCCCGCGCCACCTAGGG + Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094682721 12:32679799-32679821 CCGCGTGCCGCTGCCTCCAAGGG + Intronic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1098897814 12:76083970-76083992 CCCCGCGCGGCCGCCCCCAATGG + Intronic
1099114047 12:78601885-78601907 CCGCCCGCCCCAGCCTCCCAAGG - Intergenic
1099979656 12:89583783-89583805 CCCCCCCCCCCCCCCGCCAAAGG - Intergenic
1101186855 12:102289538-102289560 CAGCGCACCCCCTCTGCCAAGGG - Intergenic
1104697284 12:130872532-130872554 TCGCGCGGCCCCGCAGCCCATGG - Intronic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1105000423 12:132687092-132687114 CGGCGCGCCCCGACCGCCGACGG - Intronic
1111397053 13:87677587-87677609 CCGCGGGCCCGCGCTGCCCAAGG + Exonic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1114525534 14:23365337-23365359 CGGGGCGCCCCCGCGGCCTAGGG - Exonic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1121184095 14:91951538-91951560 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1124328058 15:28783970-28783992 CCGCCCGCCTCCGCCTCCCAGGG + Intergenic
1128455241 15:67828150-67828172 CCCCGCGCCCGCCCCGCCAGTGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132483908 16:180592-180614 CTGGGCGCCCCCGCCCCCAGGGG + Intronic
1132527720 16:425905-425927 GCGCCCGCCCGCGCCGCCGAGGG + Exonic
1132604589 16:788429-788451 CGGCCCGCCCCCGCCGCGGAAGG + Intergenic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132900944 16:2253994-2254016 CCCCGGGCCGCCGCCGCCACAGG - Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136540222 16:30924379-30924401 CCCGGCCCCCCCGCCGCCGATGG + Intronic
1137618156 16:49858725-49858747 CCCCACGCCCCCGCGGCCCAGGG + Intergenic
1138619285 16:58198288-58198310 CCTCGCCCTCCCGCCGCCACAGG + Intergenic
1139472132 16:67184022-67184044 CGGCGCGCCCCCGAGGCCACTGG + Exonic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142757711 17:2025532-2025554 CCGCGCGGCGCCGCCTCCCAAGG + Intergenic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148722463 17:49763834-49763856 ACGCGCCCCCCCTCCCCCAATGG + Intronic
1151205232 17:72501802-72501824 CCTCGCTCCCCAGCCGCCCAAGG + Intergenic
1151313980 17:73311000-73311022 CCGCGCGCACCCGCCCCAAGCGG + Intronic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1155211052 18:23602277-23602299 CCGCCCGCCTCCGCCTCCCAAGG + Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1157359699 18:46965583-46965605 CCCCCCCCCCCCGCCCCCAACGG + Intronic
1157362281 18:47031016-47031038 CCCCCCCCCCCCGCCCCCAACGG + Intronic
1160404746 18:78637882-78637904 GCGCGGGCCCCAGGCGCCAAGGG - Intergenic
1160843607 19:1157120-1157142 CCGAGGGCCCACGCCCCCAAGGG + Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161241111 19:3224558-3224580 CCGCGCGGCGCGGCCGCCAGGGG + Intergenic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168528463 19:57106729-57106751 ACGCGCCCCCCCGCCCCCTACGG - Intergenic
1202710974 1_KI270714v1_random:19205-19227 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
925959570 2:9003213-9003235 CCGAGCGCCGCTGCCGCGAAGGG + Intronic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
929789590 2:45013324-45013346 CCGAGCGCCCCAGCCGACATGGG + Intergenic
931719474 2:65056675-65056697 CCTCGCGTCCCCGCCGGCAAGGG + Intronic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
938296598 2:130182803-130182825 CCGCCCGCCACCCCCGCCACTGG - Intronic
938460150 2:131491826-131491848 CCGCCCGCCACCCCCGCCACTGG + Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
942398876 2:175580507-175580529 CACCGCGCCCCCGCCACCAAAGG - Intergenic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946966421 2:225042201-225042223 CCGCGCGCCCCAGGCGCCCGGGG - Intronic
947117932 2:226791638-226791660 CCGCCCGCCACCACCGCCAGGGG + Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168753068 20:297542-297564 CCACTCGCTCCCGCAGCCAAAGG - Exonic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1175338099 20:58209656-58209678 CCCCCCGCCCCCGCCCCCACCGG + Intergenic
1175938703 20:62527234-62527256 CCCCCCGCCCCCGCCCCCTACGG + Intergenic
1176373409 21:6075860-6075882 GCCCGCGCCCCCGCCAGCAACGG - Intergenic
1177152732 21:17470779-17470801 CCGCCCGCCTCGGCCTCCAAAGG - Intergenic
1177187968 21:17819108-17819130 CCGCGCGCCCCCAACGCCGAAGG - Intronic
1179750068 21:43462383-43462405 GCCCGCGCCCCCGCCAGCAACGG + Intergenic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181057649 22:20267719-20267741 CGGAGCGCCCCGGCCACCAAGGG - Intronic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1183560790 22:38570711-38570733 CCCCCCGCCCCCGCTGCCCATGG + Intergenic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
967684938 3:192408448-192408470 CCCCGCCCCCCGGCCGCCAGAGG - Exonic
969346755 4:6575108-6575130 CCGCCCCCGCCCGCAGCCAATGG + Intergenic
970001900 4:11372840-11372862 CCCCGGGCCGCCGCCGCCACAGG + Intergenic
970824370 4:20254035-20254057 CCGCGCACCCCTGCCTCCACTGG + Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
972740236 4:41881159-41881181 CCCCGCACCCCGGCCCCCAACGG + Intergenic
975870660 4:78776042-78776064 CCCCCCCCCCCCCCCGCCAACGG + Intergenic
979674683 4:123398349-123398371 TCCCCCGCCCCCGCCGCCACCGG - Intronic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
982070837 4:151693010-151693032 CCCAGCACCCCCGCCGCAAAGGG - Intronic
985703300 5:1386478-1386500 CCACGCGCGCCCGGCGTCAACGG - Intergenic
987239942 5:15985830-15985852 CCGCGCGCCTCAGCCTCCCAAGG + Intergenic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
997297527 5:132777270-132777292 TCTCCCGCCGCCGCCGCCAAGGG - Exonic
1000286940 5:159834903-159834925 CCCCCCACCCCCGCCGCAAAAGG + Intergenic
1000698052 5:164413870-164413892 CCGCGCGCCTCGGCCTCCCAAGG - Intergenic
1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG + Exonic
1005040414 6:21595457-21595479 TCCCGCGCCCACGCCGCCCACGG - Exonic
1006369161 6:33633682-33633704 CGACGCGCCGCCGCCGCCAAGGG - Intronic
1007648164 6:43398643-43398665 CCGCCCGCCTCGGCCTCCAAAGG + Intergenic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1013170820 6:107635023-107635045 ACGCGCGGCGCCGCCGCCGAGGG + Exonic
1013803296 6:113970821-113970843 CCGCGCGCCCACCCCGACACCGG + Intronic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1018123237 6:160657638-160657660 CTGCCCGCCCCCGCCTCCCAAGG + Intronic
1018238943 6:161753696-161753718 CCGAGCCCCCCCGCCCCCATTGG - Intronic
1019474159 7:1236126-1236148 CCGCCGCCGCCCGCCGCCAAGGG + Exonic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1019760963 7:2812384-2812406 CCGCCCGCCTCAGCCTCCAAAGG - Intronic
1020084410 7:5302895-5302917 CTGCACGCCTCCACCGCCAATGG + Exonic
1023918308 7:44606941-44606963 CCCCGCTCGCCCACCGCCAATGG - Intronic
1023945159 7:44797018-44797040 ACGCGGGCCCCCTCCCCCAACGG - Intronic
1025209884 7:57014304-57014326 CTGCACGCCTCCACCGCCAATGG - Intergenic
1025662067 7:63562547-63562569 CTGCACGCCTCCACCGCCAATGG + Intergenic
1027177788 7:75915500-75915522 CCCCGCGCCGCCGCCCCCCACGG + Intronic
1029149684 7:98470912-98470934 CGCCGCGCCCCCGCCCCCCAGGG + Intergenic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1034129278 7:148699807-148699829 CGGCGCGCCCCCGGTCCCAACGG + Intronic
1036950342 8:13133557-13133579 CCCCGCGCCTCCTCCGCCGAAGG + Intronic
1038008842 8:23457709-23457731 GTGCGCGCTCCCGCCGCCAGCGG - Intergenic
1039868853 8:41528950-41528972 GCGCCCGCCACCGCGGCCAAGGG - Intergenic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1044569344 8:93700346-93700368 CCGCGCGTCCCTGCCGGCGAAGG - Intronic
1045977849 8:108149683-108149705 CAGTGCACCCCCTCCGCCAAGGG + Intergenic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1050500655 9:6294615-6294637 CCGCCCGCCTCCGCCTCCCAAGG + Intergenic
1051459061 9:17293292-17293314 CAGCGCACCCGCTCCGCCAAGGG - Intronic
1052192843 9:25678341-25678363 CCGCGCGGCCCCTCAGCCCACGG - Exonic
1056385913 9:86097526-86097548 CACCGCTCCCCCGCCCCCAATGG + Intronic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057234294 9:93346409-93346431 CTGCGCCTTCCCGCCGCCAACGG + Exonic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1062162418 9:135087686-135087708 CCGGGCTCCTCCGCCGCCACCGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062305764 9:135906706-135906728 CCCGCCGCCGCCGCCGCCAACGG + Intronic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic