ID: 970968466

View in Genome Browser
Species Human (GRCh38)
Location 4:21954107-21954129
Sequence TAAAATGATGATAGTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968466_970968469 1 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data
970968466_970968468 -6 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968468 4:21954124-21954146 ATTTTAACAACATCCTCAGGTGG No data
970968466_970968467 -9 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968467 4:21954121-21954143 ATCATTTTAACAACATCCTCAGG No data
970968466_970968472 25 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968472 4:21954155-21954177 AAGCACATTAAAATGTGAGAAGG No data
970968466_970968473 29 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968473 4:21954159-21954181 ACATTAAAATGTGAGAAGGCTGG No data
970968466_970968474 30 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968474 4:21954160-21954182 CATTAAAATGTGAGAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968466 Original CRISPR TAAAATGATGATAGTGATTA AGG (reversed) Intergenic
No off target data available for this crispr