ID: 970968469

View in Genome Browser
Species Human (GRCh38)
Location 4:21954131-21954153
Sequence CAACATCCTCAGGTGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968464_970968469 11 Left 970968464 4:21954097-21954119 CCTCAGACCTCCTTAATCACTAT No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data
970968465_970968469 4 Left 970968465 4:21954104-21954126 CCTCCTTAATCACTATCATCATT No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data
970968462_970968469 16 Left 970968462 4:21954092-21954114 CCCTGCCTCAGACCTCCTTAATC No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data
970968466_970968469 1 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data
970968463_970968469 15 Left 970968463 4:21954093-21954115 CCTGCCTCAGACCTCCTTAATCA No data
Right 970968469 4:21954131-21954153 CAACATCCTCAGGTGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968469 Original CRISPR CAACATCCTCAGGTGGTTCC AGG Intergenic
No off target data available for this crispr