ID: 970968470

View in Genome Browser
Species Human (GRCh38)
Location 4:21954137-21954159
Sequence TGCTTACCTGGAACCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968470_970968472 -5 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968472 4:21954155-21954177 AAGCACATTAAAATGTGAGAAGG No data
970968470_970968473 -1 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968473 4:21954159-21954181 ACATTAAAATGTGAGAAGGCTGG No data
970968470_970968475 5 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968475 4:21954165-21954187 AAATGTGAGAAGGCTGGGAGTGG No data
970968470_970968474 0 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968474 4:21954160-21954182 CATTAAAATGTGAGAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968470 Original CRISPR TGCTTACCTGGAACCACCTG AGG (reversed) Intergenic
No off target data available for this crispr