ID: 970968472

View in Genome Browser
Species Human (GRCh38)
Location 4:21954155-21954177
Sequence AAGCACATTAAAATGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968465_970968472 28 Left 970968465 4:21954104-21954126 CCTCCTTAATCACTATCATCATT No data
Right 970968472 4:21954155-21954177 AAGCACATTAAAATGTGAGAAGG No data
970968466_970968472 25 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968472 4:21954155-21954177 AAGCACATTAAAATGTGAGAAGG No data
970968470_970968472 -5 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968472 4:21954155-21954177 AAGCACATTAAAATGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968472 Original CRISPR AAGCACATTAAAATGTGAGA AGG Intergenic
No off target data available for this crispr