ID: 970968473

View in Genome Browser
Species Human (GRCh38)
Location 4:21954159-21954181
Sequence ACATTAAAATGTGAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968466_970968473 29 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968473 4:21954159-21954181 ACATTAAAATGTGAGAAGGCTGG No data
970968470_970968473 -1 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968473 4:21954159-21954181 ACATTAAAATGTGAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968473 Original CRISPR ACATTAAAATGTGAGAAGGC TGG Intergenic
No off target data available for this crispr