ID: 970968474

View in Genome Browser
Species Human (GRCh38)
Location 4:21954160-21954182
Sequence CATTAAAATGTGAGAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970968466_970968474 30 Left 970968466 4:21954107-21954129 CCTTAATCACTATCATCATTTTA No data
Right 970968474 4:21954160-21954182 CATTAAAATGTGAGAAGGCTGGG No data
970968470_970968474 0 Left 970968470 4:21954137-21954159 CCTCAGGTGGTTCCAGGTAAGCA No data
Right 970968474 4:21954160-21954182 CATTAAAATGTGAGAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970968474 Original CRISPR CATTAAAATGTGAGAAGGCT GGG Intergenic
No off target data available for this crispr