ID: 970975570

View in Genome Browser
Species Human (GRCh38)
Location 4:22039455-22039477
Sequence AAAGAATTTTCGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970975570_970975573 0 Left 970975570 4:22039455-22039477 CCACACCTGGCCGAAAATTCTTT No data
Right 970975573 4:22039478-22039500 TCTTTAAGAGCGTTGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970975570 Original CRISPR AAAGAATTTTCGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr