ID: 970982514

View in Genome Browser
Species Human (GRCh38)
Location 4:22117253-22117275
Sequence CTGTAATAGCAGAGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970982510_970982514 -7 Left 970982510 4:22117237-22117259 CCACACATATGTGTAACTGTAAT No data
Right 970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970982514 Original CRISPR CTGTAATAGCAGAGGGGAAA AGG Intergenic
No off target data available for this crispr