ID: 970986535

View in Genome Browser
Species Human (GRCh38)
Location 4:22165739-22165761
Sequence TGAAAGATCTTCAAATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970986532_970986535 29 Left 970986532 4:22165687-22165709 CCTTTGTGAGAGCAAAGGCATTT No data
Right 970986535 4:22165739-22165761 TGAAAGATCTTCAAATGCCCAGG No data
970986533_970986535 -1 Left 970986533 4:22165717-22165739 CCATTTGCATGAATTAAAGCCAT No data
Right 970986535 4:22165739-22165761 TGAAAGATCTTCAAATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970986535 Original CRISPR TGAAAGATCTTCAAATGCCC AGG Intergenic
No off target data available for this crispr