ID: 970988713

View in Genome Browser
Species Human (GRCh38)
Location 4:22188631-22188653
Sequence CAGACCTTACATTCTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970988713_970988716 19 Left 970988713 4:22188631-22188653 CCCACATTAGAATGTAAGGTCTG No data
Right 970988716 4:22188673-22188695 TTATTTATTGATAATATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970988713 Original CRISPR CAGACCTTACATTCTAATGT GGG (reversed) Intergenic
No off target data available for this crispr