ID: 970989606

View in Genome Browser
Species Human (GRCh38)
Location 4:22197151-22197173
Sequence TTAATACTGTTTGTAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970989606_970989609 7 Left 970989606 4:22197151-22197173 CCTCAGCCTACAAACAGTATTAA No data
Right 970989609 4:22197181-22197203 AACCACTACTAGGAAAATTAAGG No data
970989606_970989612 19 Left 970989606 4:22197151-22197173 CCTCAGCCTACAAACAGTATTAA No data
Right 970989612 4:22197193-22197215 GAAAATTAAGGTAAAAATTAGGG No data
970989606_970989611 18 Left 970989606 4:22197151-22197173 CCTCAGCCTACAAACAGTATTAA No data
Right 970989611 4:22197192-22197214 GGAAAATTAAGGTAAAAATTAGG No data
970989606_970989608 -3 Left 970989606 4:22197151-22197173 CCTCAGCCTACAAACAGTATTAA No data
Right 970989608 4:22197171-22197193 TAATAAGAAAAACCACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970989606 Original CRISPR TTAATACTGTTTGTAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr