ID: 970989609

View in Genome Browser
Species Human (GRCh38)
Location 4:22197181-22197203
Sequence AACCACTACTAGGAAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970989606_970989609 7 Left 970989606 4:22197151-22197173 CCTCAGCCTACAAACAGTATTAA No data
Right 970989609 4:22197181-22197203 AACCACTACTAGGAAAATTAAGG No data
970989607_970989609 1 Left 970989607 4:22197157-22197179 CCTACAAACAGTATTAATAAGAA No data
Right 970989609 4:22197181-22197203 AACCACTACTAGGAAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970989609 Original CRISPR AACCACTACTAGGAAAATTA AGG Intergenic
No off target data available for this crispr