ID: 970993214

View in Genome Browser
Species Human (GRCh38)
Location 4:22236643-22236665
Sequence CTGGCTTCACCTGGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970993204_970993214 27 Left 970993204 4:22236593-22236615 CCTCCTACTTCAGTCTGCTAAGT No data
Right 970993214 4:22236643-22236665 CTGGCTTCACCTGGTTTTAATGG No data
970993206_970993214 24 Left 970993206 4:22236596-22236618 CCTACTTCAGTCTGCTAAGTGGA No data
Right 970993214 4:22236643-22236665 CTGGCTTCACCTGGTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970993214 Original CRISPR CTGGCTTCACCTGGTTTTAA TGG Intergenic
No off target data available for this crispr