ID: 970995856

View in Genome Browser
Species Human (GRCh38)
Location 4:22267045-22267067
Sequence GGGTGGGTTATTATAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970995849_970995856 7 Left 970995849 4:22267015-22267037 CCTCTTAAGGGTCTGGATTAGTT No data
Right 970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG No data
970995848_970995856 8 Left 970995848 4:22267014-22267036 CCCTCTTAAGGGTCTGGATTAGT No data
Right 970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970995856 Original CRISPR GGGTGGGTTATTATAAAGTG AGG Intergenic
No off target data available for this crispr