ID: 971005003

View in Genome Browser
Species Human (GRCh38)
Location 4:22363522-22363544
Sequence ATGTCTCTCTACTAGTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971005003 Original CRISPR ATGTCTCTCTACTAGTATAA TGG Intronic
903730831 1:25494145-25494167 ATGTCTCAGTACTATTATGAAGG + Intronic
908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG + Intergenic
912144485 1:106775302-106775324 ATCTCAATCTACTAGTATGAAGG + Intergenic
917037969 1:170769999-170770021 ATGCCTATCTGCTAGAATAAAGG + Intergenic
918802704 1:188992682-188992704 ATGTCTCTTTACTTCCATAATGG - Intergenic
919419237 1:197350612-197350634 ATGTCTCGCTACTAGAATTTAGG - Intronic
920694678 1:208173231-208173253 ATGTGTGTTTACTAGTATTACGG + Intronic
922818567 1:228469061-228469083 ATGCTTCTCTACTAGGATGAGGG + Intergenic
1067526539 10:47042750-47042772 ATGTTTCTCTACCTGTAAAATGG + Intergenic
1068267160 10:54666490-54666512 ATGTCTCTCTCAGAGTTTAAGGG - Intronic
1069584487 10:69588946-69588968 ATGTTTCTCTACTAGGACATAGG - Intergenic
1072546005 10:96439666-96439688 GTGTTCCTCTACTTGTATAACGG + Intronic
1072834145 10:98693219-98693241 ATGTCTCACTAATTGTATACTGG - Intronic
1077694314 11:4380221-4380243 ATGTATATCTCCAAGTATAAAGG + Intergenic
1077802103 11:5549670-5549692 ACCTCTCTATACTAGGATAAGGG + Intronic
1080823364 11:35827439-35827461 ATGTCTCTCAGCTGGTGTAAAGG + Intergenic
1082829780 11:57607491-57607513 CTGTCTCTCTACTTGAATACAGG + Intronic
1083124352 11:60549113-60549135 ATGTCTTTCTACTAATTTCAGGG - Intergenic
1086194667 11:84123024-84123046 ATGTCTCTCTGCAAATATTAGGG - Intronic
1087974612 11:104529592-104529614 ATGAATCTATACTAGTTTAAGGG + Intergenic
1097742324 12:63257927-63257949 ATGTCTCTTTCCTACTAGAATGG + Intergenic
1101218726 12:102614099-102614121 ATGTCTCTCTATTTTTAAAAAGG - Intergenic
1106082421 13:26511417-26511439 ATGTCTCTCTGCTAGTTTCTGGG - Intergenic
1113164667 13:107425928-107425950 ATGTCTCTGTACTATGATATTGG + Intronic
1115128433 14:30024437-30024459 ATGTGTCTTTATTTGTATAAAGG + Intronic
1115430081 14:33307177-33307199 ATGTCACTTTACAATTATAAGGG + Intronic
1115737270 14:36346716-36346738 ATGTCACTCTCCTAGAAGAATGG - Intergenic
1118131135 14:62964916-62964938 ATCTCTCTCTACTATTGCAACGG + Intronic
1123766711 15:23487530-23487552 ATGTCTCTATACTGTTATGAAGG - Intergenic
1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG + Exonic
1132262121 15:100434824-100434846 CTGTTTCTCTACTAATAAAAAGG + Intronic
1135237178 16:20768098-20768120 ATTACTCTCTACTAGAATAGGGG - Intronic
1135614640 16:23900548-23900570 ATGTCTCTCTACTAATATATAGG - Intronic
1138915669 16:61461396-61461418 ATTTCTCTTTACTGGTATATAGG - Intergenic
1142202153 16:88766428-88766450 ATGTCTCTCTACCTGTGAAATGG - Intronic
1146128528 17:30249510-30249532 CTGCCTCCCTACTAGTATACAGG - Intronic
1149783360 17:59415687-59415709 AAGTCTCTCCATTAGTAAAATGG + Intergenic
1152944466 17:83191491-83191513 ATGTCTCTCTCCCAGAATTAAGG - Intergenic
1156719077 18:40047649-40047671 AAGTCTCTGTACTTGTATCATGG - Intergenic
1157015073 18:43702413-43702435 ACATCTTTCTACTAGTTTAAAGG + Intergenic
1159193538 18:65081373-65081395 ATTTCTCACTTCTGGTATAATGG - Intergenic
1159294849 18:66471741-66471763 ATGTCTCTCTACATGGATTAGGG + Intergenic
1164102648 19:22071286-22071308 CTGAATCTCTACTAGTATAAAGG + Intronic
928428229 2:31196918-31196940 AAGTTTCTCTATTAGTAAAATGG + Intronic
929483321 2:42333598-42333620 ATGTCTTTCTCCTAGTGTAGTGG - Intronic
932097952 2:68868507-68868529 ATGTCTCTATCCTACTATGATGG + Intronic
932979074 2:76641324-76641346 ATGTCTCTTTATGAGTAAAATGG + Intergenic
934099058 2:88634339-88634361 ATGTCTCTCCACTAGTTAACGGG + Intergenic
936689974 2:114874906-114874928 CCTTCTCTCTAGTAGTATAAGGG - Intronic
942614678 2:177778372-177778394 GTTTCTCTCTGCTGGTATAATGG - Intronic
943315517 2:186382771-186382793 ATATCTCTTTACTACTATAAGGG - Intergenic
943362284 2:186934379-186934401 ATTTCTCTCATCTATTATAATGG + Intergenic
945302647 2:208228409-208228431 ATGATTCTTTACTATTATAATGG - Intergenic
946917629 2:224541648-224541670 ATGTCTTTCAACAAGTATACAGG + Intronic
1170449949 20:16472505-16472527 ATGTAACTGTACTGGTATAAAGG + Intronic
1177553359 21:22655364-22655386 ATTACTCTTCACTAGTATAAAGG - Intergenic
1181877613 22:25952226-25952248 ATGTCTCTGTCCTGGTATCAGGG + Intronic
1182923580 22:34102497-34102519 ATGTCACTCTCCTTGTATCATGG - Intergenic
950785904 3:15435366-15435388 ATGTTTCCCTACTATTATTATGG - Intronic
954611890 3:51948711-51948733 TTGACTCTTTACTTGTATAAGGG + Exonic
954847177 3:53569574-53569596 AACTCTCCCTACTAGTATTAGGG + Intronic
955204897 3:56887009-56887031 CAGTCTCTCTAGTAGAATAAAGG - Intronic
957202390 3:77153628-77153650 ATGTCTCCTTACTAAAATAATGG + Intronic
961489278 3:127241554-127241576 ATGTTTCAGTACTAGTACAACGG - Intergenic
964157552 3:153603989-153604011 ATGCCTCTCAACTAGAATCAAGG + Intergenic
964305727 3:155337623-155337645 TTGTCTCTCTAATAGCACAAAGG - Intergenic
966381482 3:179348833-179348855 ATCTCCCTCTAGTAGCATAATGG + Exonic
971005003 4:22363522-22363544 ATGTCTCTCTACTAGTATAATGG + Intronic
975724534 4:77279093-77279115 AGGTCTCTCTACTAGGCTGAGGG + Intronic
976951661 4:90840177-90840199 TTTTCTCTCTACTAAAATAAAGG - Intronic
979160173 4:117449442-117449464 ATGTCTCTCTGGTTGTATCAGGG - Intergenic
980392098 4:132159794-132159816 TTGTCTTTCTAGTGGTATAATGG + Intergenic
983276117 4:165620118-165620140 ATGTATCTCTATTAATAGAATGG - Intergenic
986508446 5:8477193-8477215 ATTTCTTTCTACTATTAAAATGG - Intergenic
986850417 5:11805671-11805693 ATGTGTCTATACTAATATAAAGG + Intronic
989007219 5:36828316-36828338 AAGTCTTTCTACAAGTATATGGG + Intergenic
992143477 5:73822011-73822033 ATGTCTCTCCCCTATTATAAGGG + Intronic
992924135 5:81563781-81563803 ATGTTTCTCTAGTAGTTTTATGG - Intronic
997534418 5:134607064-134607086 ATGTCTCTCTTCTATTCTAGGGG - Exonic
998023377 5:138790647-138790669 ATTTCTCTTTACTAATCTAATGG + Intronic
999586826 5:153098668-153098690 CTGCCTGTCTACAAGTATAAAGG + Intergenic
1001173068 5:169439813-169439835 ATTTATATCTACTAGTATACTGG - Intergenic
1005215274 6:23520007-23520029 ATCTCTCTCTTCTAGTCTGAGGG + Intergenic
1008319583 6:50092207-50092229 ATATGTCCCTACTGGTATAAGGG + Intergenic
1008866961 6:56223977-56223999 GTGTCTCTCTCCTGGGATAAGGG + Intronic
1009827045 6:68880048-68880070 ATGTCTCGCTATTATTATCAAGG - Intronic
1015006011 6:128282676-128282698 CTGTCTCTCTATTATGATAAAGG - Intronic
1016273427 6:142318786-142318808 ATTTCTCATTACTAGAATAAAGG + Intronic
1016361361 6:143270887-143270909 ATGAATCTGTACTAGTATATAGG + Intronic
1017561996 6:155638048-155638070 ATGTCTCTCCTCTAGAACAATGG + Intergenic
1022184938 7:27958134-27958156 ATCTCTCTGTAATGGTATAAAGG + Intronic
1023267608 7:38424038-38424060 AAGTCTGACTACTAGTGTAATGG - Intronic
1023691205 7:42789894-42789916 ATGTGCCTCTACTGGTATGATGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027972575 7:85104333-85104355 AAGTATCTCTAATAGTAAAATGG + Intronic
1031291212 7:119938345-119938367 ATGTGTCTCCACTAATAGAAGGG + Intergenic
1036127322 8:6074957-6074979 ATGTCTCACTACTAGTCCACTGG + Intergenic
1041601712 8:59725595-59725617 GTCTATCACTACTAGTATAATGG + Intergenic
1042807109 8:72782923-72782945 ATCTCTCTCTTATATTATAATGG - Intronic
1047704128 8:127480660-127480682 ATGTCTCTTTAACAGTATTAAGG - Intergenic
1047986606 8:130241374-130241396 TTTTCTCTCTACTAGAAGAATGG + Intronic
1050444848 9:5709823-5709845 ATGTATCTCTAATTTTATAATGG + Intronic
1051260916 9:15263782-15263804 ATCTCTCTCTATTAGGAGAAGGG + Intronic
1052745185 9:32433569-32433591 ATGACCCACTATTAGTATAAAGG + Intronic
1054742794 9:68825677-68825699 ATTTCTCACTCCTAGCATAAAGG - Intronic
1060906540 9:127312137-127312159 ATGTCTCTCTAGTTCTATACAGG - Intronic
1185923791 X:4124189-4124211 ATATCTCTCCTCTAATATAAGGG - Intergenic
1186544734 X:10436763-10436785 ATGACTCGCTACTAGTATTTTGG - Intergenic
1188855490 X:35189901-35189923 AAGACTCTCTACCAGCATAAAGG - Intergenic
1194602662 X:95941484-95941506 ATGACTCTCTCCTAGTATCTGGG + Intergenic
1195437419 X:104861392-104861414 ATGTCTGTCTTCCACTATAAAGG - Intronic
1199970913 X:152860278-152860300 ATGTCTCTTTGCTAGTAAATGGG + Intronic