ID: 971010286

View in Genome Browser
Species Human (GRCh38)
Location 4:22426630-22426652
Sequence AGATTGTGATAACTGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971010285_971010286 -3 Left 971010285 4:22426610-22426632 CCATTTTTAAAAAGTGATTTAGA 0: 1
1: 0
2: 10
3: 145
4: 1091
Right 971010286 4:22426630-22426652 AGATTGTGATAACTGCTACAAGG 0: 1
1: 0
2: 2
3: 24
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971010286 Original CRISPR AGATTGTGATAACTGCTACA AGG Intronic
903718553 1:25387349-25387371 ACAGTGTGAGAACAGCTACAGGG - Intronic
905952239 1:41961696-41961718 TTATGGTGATAACTGATACAAGG + Intronic
906734823 1:48115474-48115496 AGCTTGTGATTAATGCTACCAGG - Intergenic
907950040 1:59174130-59174152 ACAGTGTGAGAACTGCAACAGGG + Intergenic
908795032 1:67822507-67822529 TGATTGAGATAAGTGCTAGAAGG + Intronic
909204610 1:72739455-72739477 ACATTGTTATAATTGCTTCATGG - Intergenic
909656213 1:78035722-78035744 AGATTGTAATAAGCTCTACAAGG - Intronic
909743299 1:79060313-79060335 AGGAAGTGAAAACTGCTACAAGG + Intergenic
910129652 1:83888273-83888295 AGATTGGGAGAACTTTTACAGGG + Intronic
910239885 1:85075009-85075031 AAATTGTGATAAGTGCTATCTGG - Intronic
910290199 1:85593203-85593225 AGATAGTGCTAAGTGCTACGAGG - Intergenic
910362292 1:86425409-86425431 AGATTTTAATACCTGCCACATGG + Exonic
912015377 1:105027645-105027667 AGATTGTGGTGAATGCTACCAGG - Intergenic
913706940 1:121434640-121434662 AGCTTGTGATAAATGCTGCCTGG - Intergenic
918752710 1:188292674-188292696 AGCTTGTGATAAATGCTACCTGG - Intergenic
918815635 1:189177459-189177481 ATATTGTTATATCAGCTACATGG + Intergenic
923392129 1:233522944-233522966 AGATTTTGCTAAATGCTATAGGG - Intergenic
1063176537 10:3555636-3555658 AGAGTGTGGAAAATGCTACAGGG - Intergenic
1063186721 10:3658629-3658651 AAATTGTGATAATTCCAACAAGG + Intergenic
1063590236 10:7388268-7388290 AGATGGTGATAAGTGCTATAGGG + Intronic
1065815027 10:29475524-29475546 AGATAGTGATAAGTGCTATGAGG + Intronic
1069235382 10:66065054-66065076 AAAAAGTGATAACTGCTAAAAGG + Intronic
1069248840 10:66244042-66244064 AGCTTGTGGTAAATGCTACAAGG - Intronic
1071807439 10:89139432-89139454 AGATTATGATAACTTTTAAAAGG + Intergenic
1074091381 10:110261395-110261417 TCATTATGATAAATGCTACAGGG - Intronic
1074792038 10:116899239-116899261 AGAAGGTGATAACTGCTCTAGGG + Intronic
1074817579 10:117154359-117154381 AGACAGTGTTAAGTGCTACAAGG + Intergenic
1075987962 10:126804490-126804512 AGACTGAGATCACAGCTACATGG - Intergenic
1076365565 10:129919365-129919387 GGAGTGTGATAACAGCCACAGGG + Intronic
1076508188 10:130992866-130992888 TGCTTGTGATGACTGCTTCAGGG - Intergenic
1077950023 11:6946705-6946727 TAATTGTGATAACTGCTAAAAGG - Intronic
1078662476 11:13298462-13298484 AGATGGTGATAAGTGCTAGGAGG - Intronic
1079935765 11:26614325-26614347 AGGTTGTGACAAATGCCACATGG + Intronic
1080162885 11:29199737-29199759 AGATTTTGGTAACTACTTCATGG - Intergenic
1080731500 11:34959736-34959758 AAATTCTGATAAATGCTGCATGG + Intronic
1082278680 11:50247094-50247116 AGCTGGTGACAACTGCCACAGGG + Intergenic
1085223489 11:74896318-74896340 AGGTTGTGGTAAATGCTACCAGG - Intronic
1086005975 11:82036283-82036305 ATATAGTGATAACTGGTATAGGG - Intergenic
1086018159 11:82192404-82192426 AGTATGTGAAAAGTGCTACATGG + Intergenic
1086082182 11:82915580-82915602 ACAGTGTGATAACTACTTCAAGG - Intronic
1086725293 11:90174905-90174927 AGTTTGTGTTAAGTGCTATAAGG - Intronic
1086885398 11:92199923-92199945 AGAAGGTGGTAAATGCTACAGGG + Intergenic
1087476306 11:98639380-98639402 TGGTTGTGATAAGTTCTACATGG - Intergenic
1087548769 11:99619477-99619499 AGATGGTGATGACAGCTCCATGG - Intronic
1088009847 11:104986611-104986633 AGTTTGTGATTAATGCTACCAGG - Intergenic
1090348544 11:126091088-126091110 AGAATGTGATAAAAGATACAAGG - Intergenic
1091338266 11:134790033-134790055 AGAGTGTGAGACCTTCTACATGG - Intergenic
1092056328 12:5511211-5511233 AGATGGTGATAAGTGCTATGGGG + Intronic
1092644050 12:10550230-10550252 AGATTTGGATAAATGCTATATGG - Intergenic
1094351808 12:29534836-29534858 AGATGGTGATAAATACTATAGGG + Intronic
1094365983 12:29681636-29681658 AGATTGTGGGAAGTGTTACAAGG + Intronic
1095328917 12:40933151-40933173 ACATTGTGATCAGTGCTGCATGG - Intronic
1098125625 12:67289770-67289792 AGACAGTGATAACTGAAACATGG - Intronic
1098465246 12:70779538-70779560 AGATAGTGATAAATGCTATGAGG - Intronic
1101800117 12:108014404-108014426 AGATTGTGATAATTGCTTAGAGG + Intergenic
1103274980 12:119703992-119704014 AGATTCTGATAAGTGCTACCTGG + Intronic
1103752293 12:123173368-123173390 AGATTCTGTTGACTGCAACAAGG - Intronic
1106267073 13:28120078-28120100 AAATTGTGATAAATGCTACAAGG + Intergenic
1108035882 13:46290442-46290464 AGATTGAGCCAAATGCTACAAGG + Intergenic
1108776891 13:53776483-53776505 AGATTGTGATAAATGCCAAAAGG - Intergenic
1108867479 13:54940197-54940219 TGATTGTGATTTCTGCTATAAGG + Intergenic
1109753720 13:66730525-66730547 TGACTGTGATGACTGGTACATGG - Intronic
1110722755 13:78783454-78783476 ATATTGTTATATTTGCTACATGG + Intergenic
1113208273 13:107942361-107942383 CAATTGAGAAAACTGCTACAAGG + Intergenic
1113217654 13:108061125-108061147 AGCTTGTGGTAAATGCTACCAGG - Intergenic
1114968964 14:28001822-28001844 AGTTTGTGGTAAATGCTACCTGG - Intergenic
1117795387 14:59388416-59388438 AGCTTATGATAAATGCTGCAAGG + Intergenic
1120015550 14:79469336-79469358 AGATTGTGGTAACTTCTAGGAGG + Intronic
1120034630 14:79682313-79682335 TGTTTGTGAGAACTGCAACATGG - Intronic
1120458774 14:84766753-84766775 AAATTCTGATACATGCTACATGG + Intergenic
1121967394 14:98323356-98323378 AGATAGAGGTAACTGGTACAGGG - Intergenic
1122492220 14:102126004-102126026 AAATTGTGCTAAGTGCTATACGG + Intronic
1127405838 15:58644905-58644927 AGATTTTGCTAAATTCTACAAGG + Intronic
1127921505 15:63497955-63497977 ACAGTGTGATAAGTGCTAGAAGG - Intergenic
1128117009 15:65114530-65114552 CAATTGTGATAAGTGCTACAAGG - Intronic
1129178680 15:73857867-73857889 AGATGGTGGGAACTGGTACAGGG - Intergenic
1131798232 15:96042596-96042618 AAATTTTGATACATGCTACAAGG + Intergenic
1132415553 15:101616183-101616205 ACATTGAGATAACTGGTTCAGGG + Intergenic
1133199835 16:4196865-4196887 AAATTCTGATATCTGCTACATGG - Intronic
1133622734 16:7542112-7542134 AGATTGTGATGAATGCAACAAGG + Intronic
1133649812 16:7801731-7801753 AGATTGTGATCACTCCTAGAAGG + Intergenic
1133877601 16:9749773-9749795 AGATAGTGTTAAGTGCTATAAGG + Intergenic
1137071853 16:35910582-35910604 AGTCTGACATAACTGCTACATGG + Intergenic
1137071923 16:35911141-35911163 AGTCTGACATAACTGCTACATGG + Intergenic
1138740533 16:59304317-59304339 AGATTCTGACAACTGCAATAGGG + Intergenic
1139143368 16:64295277-64295299 AGATTGTGACATATGCAACATGG - Intergenic
1140702215 16:77591523-77591545 AGATGCTGGTGACTGCTACAAGG + Intergenic
1150988143 17:70222956-70222978 AGATTTTGGAAACTGCTAGAAGG - Intergenic
1152838036 17:82547699-82547721 TGATTGTGATTTCGGCTACATGG - Intronic
1153192642 18:2559293-2559315 AAATTCTGATATATGCTACATGG + Intronic
1155782040 18:29849369-29849391 AGCTTGTGGTAACTGCTGCCAGG + Intergenic
1156252404 18:35363566-35363588 AAATTCTGATACATGCTACAAGG - Intergenic
1156293230 18:35767808-35767830 AGATTATAATAAGTGCTATACGG - Intergenic
1159222694 18:65485818-65485840 AAATTTTGATAACTGCCACAAGG + Intergenic
1166718121 19:44982035-44982057 AGATTCTGAAAACTGACACAAGG - Intronic
927007312 2:18864241-18864263 AGAATGTGATAGCTGGTACTTGG - Intergenic
928157619 2:28891127-28891149 AGCTAGTGCAAACTGCTACAAGG + Intergenic
928417753 2:31110681-31110703 AAATTGTGGTGATTGCTACAGGG - Intronic
930670079 2:54139591-54139613 AGATTGAGATAATTCATACAAGG - Intronic
931816823 2:65912079-65912101 AGATTGTGAGAAATTTTACAAGG + Intergenic
932214348 2:69957150-69957172 TGATTTTGATAACTGCATCATGG + Intergenic
932313679 2:70765438-70765460 AAATTGTGATAACAGCTATGTGG - Intronic
933030498 2:77322903-77322925 AGCATCTGATAACTGTTACATGG + Intronic
934740085 2:96714114-96714136 AGATAGTGAAAAATGCTATAAGG + Intronic
935437832 2:103055950-103055972 AGCTTGTGGTGAATGCTACAAGG + Intergenic
940603431 2:155889657-155889679 AGATAGTGATCACTTCTTCAGGG + Intergenic
940665671 2:156606081-156606103 AGCTAGTGGTAAGTGCTACATGG - Intronic
941834475 2:170001381-170001403 AGATTGTCATAAATCTTACATGG + Exonic
942197760 2:173538698-173538720 AAATTTTGACAAATGCTACATGG - Intergenic
944718477 2:202399187-202399209 AGATTGTGATAAATGCCACAGGG + Intronic
945103129 2:206282157-206282179 AGATTGTGATAAATGTTATGAGG + Intronic
946984214 2:225253593-225253615 TGATTGTGATAATGGCTTCATGG + Intergenic
948432117 2:237925847-237925869 AGAGTGTCATAACTTATACATGG - Intergenic
1168767011 20:388512-388534 ACAGTGTGATAAATGCTGCAGGG + Intronic
1169521880 20:6382774-6382796 AGATTGTGTTAATAACTACATGG - Intergenic
1169645172 20:7802704-7802726 ACATTGTGCTTCCTGCTACAGGG - Intergenic
1169731390 20:8789080-8789102 ACATTCTTATTACTGCTACAAGG - Intronic
1169999733 20:11601960-11601982 AAATTCTGATACATGCTACATGG + Intergenic
1172029727 20:31973476-31973498 AGATCGTGATAAGTGCTATGGGG + Intronic
1174478000 20:50810910-50810932 AGATGGTGATAAATGCTAAAGGG + Intronic
1177338679 21:19768298-19768320 ATAATGTCATGACTGCTACAAGG + Intergenic
1177872356 21:26589065-26589087 AGATAGTGATAAGTGTTATATGG - Intergenic
1182236352 22:28880006-28880028 AGAAGGTGATAAATGCCACAGGG + Intergenic
1182384563 22:29926028-29926050 AAAGTGGAATAACTGCTACAGGG - Intronic
1184971793 22:48027673-48027695 AAACTGTGATAAATGCTTCAGGG - Intergenic
949388155 3:3528541-3528563 ATATTGTGATAACAGCTAAGGGG - Intergenic
952547701 3:34438847-34438869 ATATTTTGATAGCAGCTACAAGG - Intergenic
952673052 3:35994126-35994148 AGCTTGTGATAAATGCTGCCAGG - Intergenic
952685537 3:36143775-36143797 AAATTGTGATAAATGATAAAAGG - Intergenic
954197603 3:49005834-49005856 AGGTTCTGTTATCTGCTACAGGG - Exonic
958838609 3:99174781-99174803 CTATTGTGAAAATTGCTACATGG - Intergenic
959794999 3:110415883-110415905 ATCTCATGATAACTGCTACAAGG + Intergenic
959925638 3:111918753-111918775 AGATTGAGATGACTTCTCCAAGG - Intronic
960210389 3:114957709-114957731 AGATGGTGATAACTCCTCCTAGG - Intronic
963179463 3:142338747-142338769 AGCTTGTGATAAATGCTGCCTGG - Intronic
967596674 3:191333018-191333040 AGATTGAGAGAACTGCTGTAAGG - Intronic
968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG + Intronic
970051875 4:11923652-11923674 TGTTTGTGAAAACTGGTACATGG + Intergenic
970642616 4:18084219-18084241 CGATTGTGATCAGTGCTACAAGG + Intergenic
971010286 4:22426630-22426652 AGATTGTGATAACTGCTACAAGG + Intronic
971296597 4:25399278-25399300 ATATTGGGATAACTGCTAAAGGG - Intronic
971984140 4:33797852-33797874 ACATTGTGATATGTGATACAGGG - Intergenic
972021663 4:34323410-34323432 AGCTTGTGATGAATGCTACCTGG - Intergenic
974089274 4:57294182-57294204 AGATTGTGAGTACTGCCACCAGG + Intergenic
974132775 4:57777233-57777255 ATGTTCTGATAACTGCTAAATGG - Intergenic
974951716 4:68591104-68591126 AGATTGGCATAATTGCTACTGGG - Intronic
975485413 4:74930127-74930149 ACATTGTGATATGTGCCACAGGG - Intergenic
976130439 4:81878284-81878306 TGGGGGTGATAACTGCTACAGGG + Intronic
977406320 4:96603799-96603821 AGATTGTGGAATCTGCTCCAGGG + Intergenic
978780308 4:112545792-112545814 AAATTCTGATACATGCTACAAGG + Intronic
979824970 4:125221332-125221354 AGCTTGTGAAAGCAGCTACAGGG + Intergenic
986230454 5:5859959-5859981 AGAATGTAAAAACTGTTACAAGG + Intergenic
987911729 5:24155371-24155393 AGCTTGTGATGAATGCTACCTGG - Intronic
988203684 5:28104927-28104949 AAATTGTGAAAACTGATACATGG - Intergenic
988265289 5:28941708-28941730 AGCTTGTGATGACTGTTACCAGG + Intergenic
989346612 5:40437373-40437395 AGCTTATGATAATTTCTACAAGG - Intergenic
989770725 5:45141660-45141682 AGACTATGACAACTGCTAGAAGG - Intergenic
989970726 5:50521258-50521280 AGCTTGTGATAAATGCTGCCTGG + Intergenic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
991285400 5:64969747-64969769 AAAGTGTGATAAGTGCTAAAGGG + Intronic
992291410 5:75283555-75283577 AGCTTGTGGTAAATGCTACCAGG - Intergenic
992838497 5:80664114-80664136 AGACTGTGATGAGTGCCACAGGG + Intronic
993864675 5:93178221-93178243 AGATTGTGGAAATTGCAACAGGG - Intergenic
994891692 5:105643951-105643973 AGACACTGAGAACTGCTACAGGG - Intergenic
995251682 5:110000457-110000479 AGTTTTGAATAACTGCTACAAGG + Intergenic
995573127 5:113502716-113502738 AGCTTGTGATAAATGCTGCCAGG + Intergenic
996494896 5:124143195-124143217 AAATTGATATAACAGCTACATGG + Intergenic
996971034 5:129368059-129368081 GGATTGTTATCACTGCTAAAGGG + Intergenic
998742541 5:145221159-145221181 CCATTGTGATAAATGCTTCACGG + Intergenic
998966793 5:147549752-147549774 AAATTCTGATATATGCTACATGG - Intergenic
1000524504 5:162339704-162339726 AGATGGTGATAAATACTATAAGG - Intergenic
1001178357 5:169494317-169494339 ATAGTGTGATGAATGCTACAGGG - Intergenic
1001563500 5:172685143-172685165 AGAGAGTGATACCTGCTTCATGG + Intronic
1002153015 5:177251489-177251511 AGACTGTTCTGACTGCTACATGG - Intronic
1003359187 6:5408105-5408127 ATATTGTGATGCCTGCAACAGGG - Intronic
1010041298 6:71388134-71388156 AGGTGGTGACAACTGCTGCAAGG + Intergenic
1012059616 6:94462488-94462510 AGTTTGTGCTAAATGCTACCAGG + Intergenic
1012185677 6:96212896-96212918 AGATTGTGAAAACTGGAACTTGG - Exonic
1012969660 6:105715621-105715643 AGAAAGTGATAACAGCTATATGG + Intergenic
1013541343 6:111113301-111113323 ACACTGTGATAACTCTTACAGGG - Intronic
1014317149 6:119882222-119882244 AGATTCTGATAACTGCTTTGCGG - Intergenic
1014748464 6:125228285-125228307 TGATTGTGATAATGGCTTCACGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016424638 6:143921272-143921294 AGATGGTGATAAATGCTATGTGG - Intronic
1017343255 6:153351149-153351171 AGATTGTGGTAACAGTTCCATGG - Intergenic
1021669922 7:23025092-23025114 ATATTGTGCTAACTGGTTCAGGG - Intergenic
1022766575 7:33418986-33419008 GGATTTTGCTAAGTGCTACAGGG - Intronic
1022814551 7:33902353-33902375 AGATTGTGATACCTACCACTAGG - Intergenic
1023183945 7:37514134-37514156 AGATGATAATAACTGCTCCATGG + Intergenic
1023262412 7:38371200-38371222 AGTTTGGGATATTTGCTACATGG + Intergenic
1024369079 7:48559374-48559396 AGCTTGTGATAAATGCTGCCAGG + Intronic
1024721461 7:52141471-52141493 AGGTCGTGAAAACTGCTACGAGG - Intergenic
1026129034 7:67605398-67605420 AGAGTGGGGTAATTGCTACATGG + Intergenic
1027412992 7:77942249-77942271 AAATTGTGATGAGTGCTAAAAGG - Intronic
1027489353 7:78803889-78803911 AAATTGTGATAGCTGGGACACGG + Intronic
1027867925 7:83672368-83672390 AGTTTGTGATTACTTCTCCATGG + Intergenic
1028066396 7:86390700-86390722 GGATTTTGATTACTGCTGCATGG + Intergenic
1029919649 7:104249284-104249306 AGATTGTGCTAACTGCTAGTAGG + Intergenic
1030318471 7:108140451-108140473 AGGCTATGATAACTGCTATAAGG + Intergenic
1032098582 7:128953723-128953745 TGATTGTGATAACGGTTTCATGG + Intergenic
1032416839 7:131742165-131742187 AGTTTGTGATTACTACTAAAGGG - Intergenic
1033581308 7:142739649-142739671 TGACTGTGATAACTGAAACAAGG + Intergenic
1039449728 8:37662686-37662708 AGATTCTCATCAGTGCTACAGGG - Intergenic
1040499041 8:47991434-47991456 TGATTGTGATTCCTGCTATACGG + Intergenic
1040580601 8:48695815-48695837 AGATTGTGACTTCTGCTTCATGG - Intergenic
1042869362 8:73383447-73383469 CGATTGTCATAAATGCTACAAGG - Intergenic
1042911939 8:73836863-73836885 AGATTGAGATAACTACAAAATGG + Intronic
1043039767 8:75248139-75248161 AGATTTTGATAACTGCAAGTAGG + Intergenic
1044974820 8:97654009-97654031 AGATGGTAATAACTGTCACATGG - Intronic
1045201314 8:99984604-99984626 AGAGTGTGATTAGTGCAACAAGG - Intronic
1046527209 8:115395798-115395820 GGATTGTGGTAAATGCTACAGGG - Intergenic
1048508351 8:135041013-135041035 AGCTTGCCATAAATGCTACATGG - Intergenic
1049489581 8:142888169-142888191 AGCTTGTGAAAACAGCCACAGGG - Intronic
1051882750 9:21856720-21856742 AGACAGTGTTAAATGCTACAAGG + Intronic
1053611315 9:39715927-39715949 AGAGAGTGATAATTGCTACAAGG - Intergenic
1054086939 9:60755233-60755255 AGAGAGTGATAATTGCTACAAGG + Intergenic
1054242205 9:62626465-62626487 AGAGAGTGATAATTGCTACAAGG + Intergenic
1054556329 9:66660981-66661003 AGAGAGTGATAATTGCTACAAGG + Intergenic
1055074082 9:72195960-72195982 AGATTGTGATAGCTTCTATAAGG + Intronic
1057469145 9:95342256-95342278 AAATTCTGATACATGCTACATGG + Intergenic
1058224881 9:102347757-102347779 AGATAGTGATAAATTCTATAAGG + Intergenic
1058578840 9:106432756-106432778 TGACTGTGATAGATGCTACAGGG + Intergenic
1058846661 9:108967278-108967300 AAATTATGATAACTGCTATGAGG + Intronic
1059484866 9:114618787-114618809 AGACTATGATAAATGCTAGAGGG - Intronic
1059635713 9:116168816-116168838 AGAGTGTGATAAATGCTATGAGG - Intronic
1061389349 9:130308773-130308795 AGATTCTGACACGTGCTACATGG + Intronic
1188217088 X:27492220-27492242 ATGTTGTGATAAAGGCTACAGGG - Intergenic
1189185953 X:39055221-39055243 AGATTGTGGTTCATGCTACAAGG - Intergenic
1189881442 X:45497712-45497734 AGATTGTGGTAAATGCTGCCTGG + Intergenic
1191149226 X:57202990-57203012 AGCTTGTGCTAAATGCTGCATGG + Intergenic
1193092598 X:77510585-77510607 AGCTTGTGTTAAATGCTACCAGG - Intronic
1193204816 X:78736206-78736228 AGCTTGTGATGAATGCTACCTGG + Intergenic
1193396611 X:80991029-80991051 AGTTTGTGATAAATGCTGCCAGG - Intergenic
1193521098 X:82529514-82529536 AGAATGTGGTATCTGTTACATGG - Intergenic
1193619867 X:83738432-83738454 AGCTTGTGTTAAATGCTGCATGG - Intergenic
1194229284 X:91301807-91301829 AGATTGTGGTAAGTGCCACCTGG - Intergenic
1194464864 X:94221085-94221107 AGATGGTGCTAAATGCTAAAAGG - Intergenic
1194834294 X:98661858-98661880 AAATTGTGATAAATTCTAAAAGG + Intergenic
1195805146 X:108757237-108757259 AGAATTTGATGATTGCTACAGGG + Intergenic
1197976660 X:132172743-132172765 GAATTGTGATTAGTGCTACAAGG - Intergenic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic
1198956452 X:142136685-142136707 AGATTGTGTTGAATGCTACATGG - Intergenic
1199050616 X:143232567-143232589 AGCTTGTGGTAAATGCTACCTGG - Intergenic