ID: 971013376

View in Genome Browser
Species Human (GRCh38)
Location 4:22463301-22463323
Sequence AAGGGACTAAGGAACCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971013376_971013385 28 Left 971013376 4:22463301-22463323 CCTCCAGGGTTCCTTAGTCCCTT 0: 1
1: 0
2: 0
3: 18
4: 230
Right 971013385 4:22463352-22463374 GGAAGTAGACCCTGGACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 139
971013376_971013381 7 Left 971013376 4:22463301-22463323 CCTCCAGGGTTCCTTAGTCCCTT 0: 1
1: 0
2: 0
3: 18
4: 230
Right 971013381 4:22463331-22463353 TGAAATGTACAAGACCTTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 170
971013376_971013382 20 Left 971013376 4:22463301-22463323 CCTCCAGGGTTCCTTAGTCCCTT 0: 1
1: 0
2: 0
3: 18
4: 230
Right 971013382 4:22463344-22463366 ACCTTCCTGGAAGTAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971013376 Original CRISPR AAGGGACTAAGGAACCCTGG AGG (reversed) Intronic
903715285 1:25361282-25361304 AAGGGACACAGGGAGCCTGGTGG - Exonic
903805891 1:26005450-26005472 AAGGGACTACGGAGCCCAGAAGG + Intergenic
905598114 1:39226271-39226293 AATGTACTAAGGAAACCTGATGG - Intronic
906293147 1:44632606-44632628 AAGGCCCTGAAGAACCCTGGGGG + Intronic
907593686 1:55700282-55700304 AAGGGACTTAGGAGCCATGCTGG - Intergenic
912877045 1:113370706-113370728 AGGTAACTAAGGAACCCAGGAGG - Intergenic
914444535 1:147738880-147738902 AAGGGACTAAGGCAGTGTGGTGG + Intergenic
914908638 1:151767211-151767233 TAGGGACTCAGGAGCACTGGAGG - Exonic
921260569 1:213382287-213382309 AAGGGGCTAATGATCCCTGTGGG + Intergenic
923583977 1:235248806-235248828 AAGGGACTAAAAAGACCTGGGGG + Intronic
924749909 1:246876896-246876918 AAGAGAATAAGGAAAACTGGAGG - Intronic
1063179108 10:3581345-3581367 TAGGGACTAAAGAGCCATGGAGG - Intergenic
1063709094 10:8459786-8459808 ATGAGACTAAGGACCCTTGGAGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065985177 10:30943738-30943760 AAGGAACTAAGGAACAAAGGTGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067508951 10:46879155-46879177 AAAGGACTGAGGAAGGCTGGGGG - Intergenic
1067653301 10:48172695-48172717 AAAGGACTGAGGAAGGCTGGGGG + Intronic
1068908171 10:62350724-62350746 AAGTGACTTAAGAACCTTGGAGG - Intergenic
1071088510 10:81892332-81892354 AAGGGTATGAGGAGCCCTGGAGG + Intronic
1071922056 10:90361519-90361541 AAGGTACTAAGGAATGTTGGAGG - Intergenic
1073631876 10:105157365-105157387 AAGGGTCTTAGGAACTCAGGTGG + Intronic
1073836213 10:107445784-107445806 AAGGGCCTAAAGCAGCCTGGTGG - Intergenic
1074936847 10:118190410-118190432 AAGGAACTAAGGCAGCATGGAGG + Intergenic
1075566947 10:123511929-123511951 AAGGGTCTCAAGGACCCTGGAGG - Intergenic
1077351168 11:2093817-2093839 AAGGTGCTGGGGAACCCTGGGGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078715926 11:13838925-13838947 AGGAGACTAAGGAACGCAGGAGG - Intergenic
1081630826 11:44688501-44688523 AAGAGAGTAAGGGAGCCTGGGGG - Intergenic
1081986543 11:47308981-47309003 AAGGGACAAAGGATCCATGTGGG + Exonic
1083183015 11:61000382-61000404 AAGGGACGATGGAAACATGGAGG - Intronic
1083183981 11:61007116-61007138 CAGTGACTAGGGAACCTTGGAGG - Intronic
1083430344 11:62611111-62611133 AAGGGCCTGAGGATCCCCGGGGG + Exonic
1083721381 11:64605285-64605307 AAGGGTGTGAGGAAGCCTGGCGG + Intergenic
1083950571 11:65953471-65953493 AAGGGAATATGGAAGCCTGTGGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1084940579 11:72610583-72610605 GAGGGACCAAGGAAGCCTGGGGG - Intronic
1085120328 11:73963545-73963567 ATGGGACTCAGGAACCCTTGGGG - Intronic
1085730422 11:78993224-78993246 AAGGTGCTAAGGGAGCCTGGAGG + Intronic
1085805608 11:79633301-79633323 AATGAACTAATGAACACTGGTGG + Intergenic
1089298125 11:117481685-117481707 AAGGGAGAATGGAGCCCTGGGGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093524593 12:20092187-20092209 AAGAGATTAAGGAATCATGGTGG + Intergenic
1094435641 12:30418107-30418129 AGGTGACTAAGGAACACTTGTGG - Intergenic
1094640951 12:32275291-32275313 AAGGTATAAAGGAACCCTGGCGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1096678590 12:53240215-53240237 AAAGGAATAAGGAAGGCTGGAGG - Intergenic
1100622716 12:96294755-96294777 AAGGGTCTCAGGAGCCCTAGGGG + Intronic
1105323959 13:19353424-19353446 AAGGGAGGAAGGCACCCTGAGGG - Intergenic
1105323973 13:19353537-19353559 AAGGGAGGAAGGCACCCTGAGGG - Intergenic
1105323987 13:19353650-19353672 AAGGGAGGAAGGCACCCTGAGGG - Intergenic
1105324001 13:19353763-19353785 AAGGGAGGAAGGCACCCTGAGGG - Intergenic
1105436744 13:20386126-20386148 AAGTGACTATGGAATCCTAGTGG + Intergenic
1105869979 13:24495998-24496020 AAGGGAGGAAGGCACCCTGAGGG + Intronic
1105869993 13:24496109-24496131 AAGGGAGGAAGGCACCCTGAGGG + Intronic
1106017304 13:25881922-25881944 AATGGACTCAGGCACTCTGGTGG - Intronic
1107286871 13:38802864-38802886 GAGGGAATATGGAGCCCTGGGGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107768697 13:43766248-43766270 AAGGGACTGAGGGATCCTGAAGG + Intronic
1111406585 13:87814398-87814420 AAAGGGCAAAGGAATCCTGGAGG + Intergenic
1112078803 13:95943409-95943431 AAGATACTTAGGAAACCTGGGGG - Intronic
1113487244 13:110663234-110663256 AAGGGACTGCGGAAACCTGCGGG + Intronic
1113834867 13:113322169-113322191 AAGGCAAAGAGGAACCCTGGCGG - Intronic
1114743547 14:25122510-25122532 AAGGGAATAAGGCACCCTGAAGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1119443642 14:74646543-74646565 AAGGGTCAAAAAAACCCTGGAGG + Intergenic
1124079788 15:26481257-26481279 AAAGGACAAAGGAGACCTGGGGG - Intergenic
1124665562 15:31588831-31588853 CAGGGACTATGGCAGCCTGGAGG + Intronic
1125746543 15:42000990-42001012 CAGGGGCTCAGGACCCCTGGGGG + Intronic
1125760639 15:42093619-42093641 CAGACACTAAGGAGCCCTGGGGG - Intronic
1126778322 15:52118291-52118313 AAGGGTCTCAGGGACCCTCGGGG - Exonic
1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG + Intergenic
1128379763 15:67103982-67104004 AAGGGAGACAGGAAGCCTGGAGG + Intronic
1128897897 15:71392619-71392641 AAGGTTCTAATGAACCCTGAGGG + Intronic
1129002788 15:72347926-72347948 AAAGGACAAGGGAACCCTGCAGG + Intronic
1129654635 15:77515951-77515973 TAGAGACTAAGGGCCCCTGGAGG - Intergenic
1130390375 15:83448860-83448882 AAGGTGTTAAGGAGCCCTGGAGG + Intronic
1131384549 15:91992962-91992984 AAGAGTCTAAGGAACCTTGAAGG + Intronic
1131809500 15:96158165-96158187 AAGGGATCAAGGAAAGCTGGAGG + Intergenic
1132890712 16:2203201-2203223 AGGAGACTGAGGAACCCAGGAGG + Intergenic
1132933328 16:2469507-2469529 AAGGGTGGGAGGAACCCTGGGGG - Intergenic
1136095976 16:27956983-27957005 GAGAGACAAAGGAACCCTTGAGG + Intronic
1136223366 16:28843179-28843201 AAGGAATGAAGGCACCCTGGAGG - Intronic
1137446602 16:48536052-48536074 CAGGGATGGAGGAACCCTGGAGG + Intergenic
1137766969 16:50985233-50985255 AAGGGTCTGGGGAGCCCTGGAGG + Intergenic
1139546207 16:67650866-67650888 AAGGGAGTGAGTAGCCCTGGAGG - Intronic
1141980617 16:87547794-87547816 ATGGGACGCAGGATCCCTGGTGG + Intergenic
1143274908 17:5703238-5703260 AAGGGCCCAAGCAACCCTTGGGG + Intergenic
1143673079 17:8410234-8410256 AAGGGGCTAAGCAAACATGGGGG + Intergenic
1145990504 17:29076620-29076642 AAGGCACTTAGGGACTCTGGGGG + Exonic
1146146702 17:30425105-30425127 AAGAGACTAAAGAAAACTGGAGG - Intronic
1147477296 17:40724405-40724427 TAGGGACCAGGGAACCCTGCAGG - Intergenic
1147478837 17:40739843-40739865 AAGGGTCGGAGGAACCCAGGAGG - Intergenic
1148879272 17:50713264-50713286 AATGGACTAAGAAAGTCTGGTGG - Intergenic
1149603848 17:57911153-57911175 CAGGGAATCAGGAACTCTGGGGG - Intronic
1150772957 17:68057032-68057054 AAGCCACTTAGGAGCCCTGGGGG - Intergenic
1151351549 17:73534914-73534936 CTGGGTCTAAGGAACCCAGGAGG + Intronic
1151906796 17:77054170-77054192 AGGAGACTCAGGAACCCTGGGGG - Intergenic
1155092452 18:22524895-22524917 AAGGTACAAAGGTCCCCTGGAGG + Intergenic
1156837354 18:41570176-41570198 AAAGAAATAAGGAACACTGGGGG - Intergenic
1156930407 18:42635526-42635548 AAGGGACTAAGAAACCCTTATGG - Intergenic
1159093302 18:63873164-63873186 ATGGGAATAGAGAACCCTGGAGG - Intronic
1160269949 18:77374536-77374558 AGGGGACCAAGGAAACCTGCTGG - Intergenic
1160842518 19:1152574-1152596 AAGGGACTCAGGAACTAGGGAGG + Intronic
1160949139 19:1657412-1657434 AGAGGACTAGGGAACCATGGTGG + Intergenic
1161480117 19:4506174-4506196 AAGGGAGTTGGGAGCCCTGGAGG - Intronic
1163640110 19:18457296-18457318 AAGGGTCTGAGGAACCCAGGGGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1168359460 19:55726480-55726502 TAGGGATTAAGGACCGCTGGAGG + Intronic
925545104 2:5007239-5007261 AAGTGCCTAAGGAAACATGGTGG + Intergenic
925613753 2:5725782-5725804 AAAGGACTGAGGACTCCTGGGGG - Intergenic
926416927 2:12658574-12658596 AAGGAACTAAGGTAGCCTGGTGG + Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934537801 2:95150704-95150726 AAGGGTTTCAGGAAACCTGGAGG - Intronic
936042327 2:109159379-109159401 AAGGGACTTGGGAACCAGGGCGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
943678433 2:190741619-190741641 AAGGAAGTGAGGAACCCTGGAGG - Intergenic
946853184 2:223927900-223927922 CAGGGAATAAGGAGGCCTGGGGG + Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948364397 2:237445326-237445348 AAGGGACCAAGTATCCCTTGAGG - Intergenic
1168939552 20:1697050-1697072 AAGAGACTCAGCCACCCTGGGGG + Intergenic
1168994771 20:2124978-2125000 AAGGGACAGATGATCCCTGGGGG - Intronic
1169505706 20:6209117-6209139 AAGGGAGGAAGGAAACATGGAGG - Intergenic
1170869216 20:20189354-20189376 TATGGTCTAAGGAACCTTGGGGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173004478 20:39129178-39129200 AAGGGCCTAGGAAGCCCTGGAGG + Intergenic
1174853689 20:54022120-54022142 TAGGGACTAAGCAACAATGGAGG + Intronic
1175912141 20:62410105-62410127 AAGGGACCAGGGCACCCTCGGGG - Intergenic
1177273618 21:18878202-18878224 GAGTGAGTAAGCAACCCTGGGGG - Intergenic
1178231565 21:30790945-30790967 AAGTGACTTAGGAATCCCGGGGG - Intergenic
1178522690 21:33299595-33299617 AAGGAACAAAGGTGCCCTGGAGG - Intergenic
1180115829 21:45704342-45704364 AAAGGAGTAAGGAAACATGGTGG + Intronic
1181422450 22:22811312-22811334 ATGGGACTAAGTAATGCTGGGGG + Intronic
1183139363 22:35922055-35922077 AGGGGACTTAGGAAAGCTGGAGG - Intronic
1183527826 22:38334512-38334534 GAGGGAGTTAGGAGCCCTGGGGG + Intronic
1184763936 22:46561939-46561961 GAGGGCCTAAGGAACCTGGGGGG + Intergenic
952591745 3:34963471-34963493 AAGGCCCTGAGGAACACTGGGGG - Intergenic
953362135 3:42306945-42306967 AAGGAAATAAGGAACCCATGGGG - Intergenic
953466063 3:43120409-43120431 AAGGGAGTAAGGAAGGCTGAGGG + Intergenic
954254889 3:49397924-49397946 AACGGACTAAGGAATCTTAGCGG + Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959009929 3:101062894-101062916 AAGGAACAAAAGGACCCTGGTGG - Intergenic
959549089 3:107633888-107633910 GAGGGGCTAAGAAACCCTGTTGG - Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961537437 3:127578723-127578745 AAGGGGCTGGGGAAGCCTGGAGG - Intronic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962607344 3:137043999-137044021 AAGGCATTAAGGCACCCTTGGGG - Intergenic
963757875 3:149255091-149255113 AAGGGACTACGGTAACCTGCAGG + Intergenic
964435338 3:156645487-156645509 TAGTGACTAAGGAACTCTGAAGG + Intergenic
965590869 3:170358421-170358443 AAGGGACACGGGAAGCCTGGGGG - Intronic
965936676 3:174122473-174122495 AAAAGACTAAGGGATCCTGGTGG - Intronic
967991183 3:195132042-195132064 AAGGAACTAAGGAACCCAGTGGG + Intronic
968800996 4:2743206-2743228 TAGGGACTGAGCAACCCTCGAGG + Intronic
969621533 4:8281213-8281235 AAGGCACGAAGGTACCATGGTGG - Intronic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970918879 4:21369505-21369527 GAGGGTCTCAGGAACCCAGGAGG + Intronic
971013376 4:22463301-22463323 AAGGGACTAAGGAACCCTGGAGG - Intronic
971347286 4:25822928-25822950 AAGGGACAAAGGAACCTGGAGGG + Intronic
977057079 4:92205640-92205662 AAAGCAGTAAGGAACTCTGGGGG - Intergenic
977432883 4:96954450-96954472 AAGGGACTGTGGAACACAGGAGG - Intergenic
978746153 4:112196769-112196791 AAGTGACTGAGGTACCATGGAGG - Intergenic
981965173 4:150591593-150591615 AAAGGGCTAAGGCACCCCGGGGG + Intronic
983975385 4:173927406-173927428 AAGGAACCAAGGAATCATGGTGG - Intergenic
984671279 4:182490730-182490752 AAGGGACTTGGCAACCTTGGTGG + Intronic
984843405 4:184089717-184089739 GAGGGACAAACGAACCCTTGAGG - Exonic
986994050 5:13585983-13586005 AGGGTTCGAAGGAACCCTGGAGG + Intergenic
987025892 5:13926116-13926138 CAGGGACCTAGGAACCCAGGTGG + Intronic
988575987 5:32425269-32425291 AAGGGTCTCAGGAACCCTTAGGG - Intronic
988714054 5:33807150-33807172 AAGGGAATGTGGAACCCTGGAGG - Intronic
988852297 5:35191870-35191892 AAGGCACTGAGGAAGCCTGGTGG - Intronic
991722081 5:69503051-69503073 AAGTGACTAATCAACCATGGAGG + Intronic
992573909 5:78091468-78091490 GTGGGTCTAAGGAAGCCTGGGGG - Intronic
996578426 5:125001868-125001890 AAAGGACCAAGTAATCCTGGAGG - Intergenic
998043198 5:138966467-138966489 AATGGCCTGAGGAAGCCTGGTGG - Intronic
998231066 5:140361734-140361756 AAGTGATTAGGGAATCCTGGTGG + Intronic
1000940273 5:167352255-167352277 AAGGCAATAAGGAACAGTGGGGG - Intronic
1001631341 5:173177805-173177827 AAGGTGCAGAGGAACCCTGGAGG + Intergenic
1001936668 5:175710380-175710402 AAGAGACTAAGCACCTCTGGGGG - Intergenic
1003240757 6:4343819-4343841 AAGAGACTGAGGCACCCTGGAGG - Intergenic
1004351471 6:14893732-14893754 AAGGGACTAAGACACCTTGTTGG - Intergenic
1007699800 6:43759863-43759885 CAGGGACTACGGAACCATGTTGG - Intergenic
1009506833 6:64493958-64493980 AAGGGACTAAGGGGTCCTGAAGG + Intronic
1011158084 6:84355993-84356015 AAGGGAGTGAGGAAACCTGCAGG - Intergenic
1015364231 6:132379001-132379023 AAAGGAATTAGGAACCCAGGAGG - Intronic
1016836627 6:148483584-148483606 AAGGGAGTGGGGAGCCCTGGAGG + Intronic
1016939913 6:149475124-149475146 AAGGGAGAAAGCAACCCTGCAGG + Intronic
1017946492 6:159100419-159100441 AAGGGACTGAGGAGTCCTGTGGG - Intergenic
1018126593 6:160689102-160689124 ACTGGGCTAAGGAACCCTGCAGG + Intergenic
1020139693 7:5605655-5605677 AGGGGAGTAGGGAACCCGGGCGG - Exonic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021528223 7:21612575-21612597 AAGAGACTAAGAAGCCCTGATGG + Intronic
1022054823 7:26719480-26719502 AAGGGAGTCAGGCATCCTGGGGG - Intronic
1023246937 7:38215214-38215236 ACGGGACTCAGGAAAGCTGGTGG - Intronic
1026552585 7:71380918-71380940 TAGGGACTCAGAATCCCTGGAGG - Intronic
1028037914 7:86008471-86008493 AAGGGAATAAGAAATGCTGGAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030677181 7:112396117-112396139 AAAGTACTAAGGGAGCCTGGAGG - Intergenic
1031999230 7:128254027-128254049 AAGGGACTAGGGAAGGCTGGGGG + Intronic
1032094732 7:128932361-128932383 TAGGGGCTGAAGAACCCTGGCGG - Intergenic
1034462194 7:151204240-151204262 AAGGGCTTCAGGAACCTTGGCGG - Intronic
1035917710 8:3643379-3643401 AAGGCACTCAGGGACTCTGGAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038397719 8:27259283-27259305 AAGGGACTTAGGAGACTTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038865546 8:31435319-31435341 AAGAGACTACTGAAACCTGGGGG + Intergenic
1040416808 8:47202821-47202843 AAGGGACTCTGCATCCCTGGAGG - Intergenic
1042667330 8:71221331-71221353 AAGGTACAAAGGAACCCCGGGGG + Intronic
1044472072 8:92582074-92582096 AAGGGATTAAGAAACCATAGAGG - Intergenic
1044644958 8:94430532-94430554 AAGTGAATTAGAAACCCTGGGGG - Intronic
1045677093 8:104619265-104619287 AATGGATTCAGGAACCCAGGTGG + Intronic
1046782119 8:118226770-118226792 AAGGTACTAAGGCAGCTTGGGGG + Intronic
1048024649 8:130574895-130574917 AAAGGTCTTAGGACCCCTGGGGG + Intergenic
1048417303 8:134241860-134241882 AAAGGACCAAGGAACCCAGTTGG - Intergenic
1048561634 8:135544825-135544847 AAGGCACTCAGGAACCAGGGAGG + Intronic
1048922864 8:139246656-139246678 CAGAGACAGAGGAACCCTGGGGG - Intergenic
1051262903 9:15282363-15282385 TAGATACCAAGGAACCCTGGGGG + Intronic
1055082707 9:72282797-72282819 AAGGAACTAAGGGACTCTGCAGG - Intergenic
1055437992 9:76311523-76311545 AGGGGACCAAGGAAACCAGGAGG - Intronic
1056691774 9:88814003-88814025 AAGGCACATAGGGACCCTGGAGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057413962 9:94845161-94845183 TTGGGAATAAGGAACCCTGCTGG + Intronic
1059405517 9:114096543-114096565 AAGGAGCAAAGGAATCCTGGCGG + Intronic
1059704404 9:116807200-116807222 AAGGGACTCAGGAACTCAGATGG + Intronic
1060772738 9:126344655-126344677 AAAGGACTAAGACACCATGGAGG - Intronic
1060814452 9:126627266-126627288 AAGGGAAGAAGGGTCCCTGGGGG - Intronic
1061503976 9:131020243-131020265 ATGGGGCTAAGGGACCCTGCTGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186199363 X:7141051-7141073 CAGGGACTAGGGAGGCCTGGAGG - Intronic
1188695495 X:33185470-33185492 AAAGGATTAGAGAACCCTGGGGG - Intronic
1191862542 X:65677808-65677830 AGGGGAATAAGGAACCTGGGAGG - Intronic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1194617971 X:96130846-96130868 AAGGGACTAAGAAACTCTGAAGG - Intergenic
1197807960 X:130415596-130415618 AATAGACCAAGGAGCCCTGGGGG + Intergenic
1198156283 X:133963996-133964018 CAGAGAGAAAGGAACCCTGGGGG - Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201637369 Y:16139096-16139118 AAGGGACAAGGGAAACCTTGGGG + Intergenic