ID: 971013760

View in Genome Browser
Species Human (GRCh38)
Location 4:22466367-22466389
Sequence ACGTGGGTGAAGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 9, 3: 21, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971013760_971013766 -7 Left 971013760 4:22466367-22466389 CCTCCATCCCTCTTCACCCACGT 0: 1
1: 0
2: 9
3: 21
4: 299
Right 971013766 4:22466383-22466405 CCCACGTATCCTTGAGGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 101
971013760_971013768 -6 Left 971013760 4:22466367-22466389 CCTCCATCCCTCTTCACCCACGT 0: 1
1: 0
2: 9
3: 21
4: 299
Right 971013768 4:22466384-22466406 CCACGTATCCTTGAGGCCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971013760 Original CRISPR ACGTGGGTGAAGAGGGATGG AGG (reversed) Intronic
901226133 1:7613909-7613931 AGGTGGGAGGAGAGAGATGGTGG + Intronic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
902515372 1:16986955-16986977 ACCTGGGGGTACAGGGATGGGGG + Exonic
903202833 1:21756525-21756547 AGGTGGGTGGAAAGGGGTGGGGG - Exonic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
905114996 1:35630922-35630944 ATGTGGGTGAGGAGGAATGTGGG + Intronic
905228174 1:36493346-36493368 ACAAGGGAGTAGAGGGATGGTGG + Intergenic
905869333 1:41394294-41394316 ACCTGGGTCAAGAGAGATGTGGG + Intergenic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
908211789 1:61907589-61907611 ATGTGGGTGGAAAGGGATGTAGG - Intronic
908672512 1:66563697-66563719 ACTTGGGTGGAGGGGGGTGGGGG - Intronic
911679413 1:100697602-100697624 ACTAGAGTGAAGAGGGAAGGAGG - Intergenic
912947337 1:114096089-114096111 AAGTGGGGGAGGAGGGGTGGTGG + Intronic
912960566 1:114191873-114191895 AGGTGAATGAAGAGTGATGGAGG + Intergenic
913045747 1:115072317-115072339 ATGAGGGAGAGGAGGGATGGAGG - Intronic
914328619 1:146645545-146645567 AGGTGGGGGGAGAGGGAGGGAGG - Intergenic
915102103 1:153508025-153508047 ACTTGGTTGAAGGGGGAAGGAGG - Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915722758 1:157996072-157996094 TGGTGGGGGAATAGGGATGGGGG + Intronic
915800295 1:158784138-158784160 GTGTGGGTGGAGAGGGGTGGAGG - Intergenic
916450074 1:164912372-164912394 GTGTGGGTGAATAGGCATGGAGG + Intergenic
917198821 1:172494607-172494629 ACCTTGGTGAAGAGGGATTCTGG + Intergenic
920562698 1:206950241-206950263 ACCTTGGGGAAGAGGGATGGTGG + Intergenic
920785030 1:209033180-209033202 GCTTGGGTGAAGAGGGAATGAGG + Intergenic
921186184 1:212671570-212671592 TCGGGGGTGAAGAAGGATCGGGG - Intergenic
921257453 1:213355274-213355296 GAGTGGGTGAAGGGGGCTGGTGG + Intergenic
921304236 1:213779967-213779989 ACATGGGTGCAAAGGAATGGGGG + Intergenic
923205814 1:231757986-231758008 ACCTGTGTGAGGAGGGGTGGGGG + Intronic
923482518 1:234397603-234397625 AGGTGGGGGAAGAGGGGAGGAGG + Intronic
923482529 1:234397623-234397645 AGGTGGGGGAAGAGGGGAGGGGG + Intronic
924539890 1:244970737-244970759 AAGAGGGTGAAGAGGGCGGGAGG - Exonic
1062798005 10:358730-358752 AGGTGGGGGACGGGGGATGGGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063828755 10:9928766-9928788 CCCTGTGTGAAGGGGGATGGTGG - Intergenic
1064418029 10:15167997-15168019 ACGTGGGTGGAGCGGCGTGGAGG - Intronic
1064453697 10:15467222-15467244 AGGGGAGAGAAGAGGGATGGAGG + Intergenic
1064674418 10:17747042-17747064 GCATGGGTGAAGTGGGGTGGAGG - Intergenic
1065720462 10:28624057-28624079 ACCTGAGTGAAGAGTGATGGAGG - Intergenic
1070922800 10:80199018-80199040 ACGTGGTTGAGGGTGGATGGAGG - Intronic
1070967528 10:80538610-80538632 ACTGGGGTGATGAGGGCTGGGGG + Intronic
1073600728 10:104843600-104843622 ACGAGGGAGAAGAGGGATGTGGG + Intronic
1076520154 10:131076293-131076315 ACTGGGGTGCAGAGGGATGGAGG - Intergenic
1077385354 11:2267188-2267210 GGGTGGGTGAAGAGGGTAGGGGG - Intergenic
1078187204 11:9062158-9062180 AGTTGGGGGAAGAGGGATGAGGG - Intronic
1079251944 11:18792998-18793020 GCGTGGGAGAAGGGGGAGGGTGG - Intergenic
1079363942 11:19792830-19792852 ACTTGGGTTGTGAGGGATGGGGG + Intronic
1079920318 11:26425731-26425753 AGGTGGGTGAATAGGGAGGGTGG + Intronic
1080829503 11:35878228-35878250 TGGTGGGGGAAGAGGCATGGTGG - Intergenic
1081418834 11:42847645-42847667 ACGTGTGTGTAGAGGTTTGGAGG - Intergenic
1081986288 11:47306627-47306649 AGATGGGGGAAGGGGGATGGGGG + Intronic
1082812074 11:57484460-57484482 GCCTGGGTGAAGAAGGATGGGGG + Intergenic
1083168911 11:60910476-60910498 AGGAGGGGGAAGAGGGAGGGGGG - Intergenic
1083758324 11:64802952-64802974 CGGAGGGTGAAGCGGGATGGGGG + Intronic
1083759582 11:64808238-64808260 ACGTGGGAGGGAAGGGATGGAGG - Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1086876771 11:92105961-92105983 ATGGAGGGGAAGAGGGATGGAGG + Intergenic
1088373617 11:109117703-109117725 ATGTGGGTGAATAGGGGAGGAGG - Intergenic
1088837128 11:113587211-113587233 ATGGGGGTGAAGAGGAAGGGAGG + Intergenic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089180917 11:116582310-116582332 ACGGGGGTGAAAGGGGTTGGTGG - Intergenic
1090973284 11:131660696-131660718 AGGGTGGTGAAGAGGGACGGAGG + Intronic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1096493000 12:52023282-52023304 GCGAGGGTGGAGAGGGAGGGCGG - Intronic
1097186321 12:57198346-57198368 ATGTGGCTGAGGAGGGTTGGGGG + Intronic
1097265235 12:57740539-57740561 AGGAGGGTGAGGAGGGGTGGAGG - Intronic
1097309353 12:58101716-58101738 AAGAGTGTGAAGAGGAATGGAGG + Intergenic
1097777028 12:63658892-63658914 ATGTGGGTGAAGAGAAATGAAGG + Intronic
1098094863 12:66944521-66944543 ACGTGGGGGTGGAGGGGTGGGGG + Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1101252309 12:102948415-102948437 GGGTGGCTGAAGAGGAATGGAGG + Intronic
1101431163 12:104628618-104628640 ATGAGGCTGAAGAGGGAGGGAGG - Intronic
1101565842 12:105904360-105904382 AAGTAGGGGAAGAGGGCTGGAGG + Intergenic
1101815802 12:108145209-108145231 AATTAGGTGAAGAGGGGTGGGGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102813396 12:115843177-115843199 ACGTGGTTGGACTGGGATGGAGG + Intergenic
1104848720 12:131860794-131860816 ATGTGAGGGAAGAGGGAGGGAGG + Intergenic
1105258407 13:18760531-18760553 AGGTGGGTGGGGAGGGTTGGGGG - Intergenic
1105261069 13:18779830-18779852 AGGTGGGTGGGGAGGGTTGGGGG - Intergenic
1106239719 13:27901468-27901490 ACGGGGGTGAGGAGGCAGGGTGG - Intergenic
1110355060 13:74558078-74558100 TCAAGGGTGAAGAGGGAAGGAGG - Intergenic
1112387885 13:98957108-98957130 GCGTGGCTGCAGAGGGAAGGAGG - Intronic
1113227443 13:108174941-108174963 ATGTGGGGGAACATGGATGGAGG + Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114633204 14:24172674-24172696 AGGTGGGAGAATGGGGATGGAGG - Intronic
1117063221 14:51983612-51983634 ACCTGGGTAAAGAGCGAGGGTGG - Intergenic
1118533665 14:66733943-66733965 ACTAGACTGAAGAGGGATGGTGG - Intronic
1119544001 14:75458913-75458935 ACGTGGCTGGAGAGGGGAGGAGG + Intronic
1119569818 14:75660741-75660763 ATGGGGGAGAAGAGGGATGTAGG - Intronic
1120025953 14:79584469-79584491 ACATAGGTGATTAGGGATGGGGG + Intronic
1121547097 14:94770351-94770373 GGGTGGGGGAAGAGGGTTGGGGG + Intergenic
1121626468 14:95389035-95389057 ACGTGGGTGAAAAAGGAAAGAGG + Intergenic
1122427392 14:101619955-101619977 GGGTGGGGGAAGTGGGATGGGGG - Intergenic
1122703345 14:103605063-103605085 AAGTGGGTGGAGAGGGGGGGTGG - Intronic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1123065300 14:105616083-105616105 ACGTGGGTGCTGAGGGGAGGAGG + Intergenic
1124918861 15:34004681-34004703 TAGTGGGTGGAGAGGAATGGTGG + Intronic
1125079712 15:35657986-35658008 GGGTGGGTGGAGAGGGATGCAGG - Intergenic
1126202065 15:45997781-45997803 TTGTGTGTGGAGAGGGATGGGGG - Intergenic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128567485 15:68710899-68710921 AGCTGGGTGGAGAGGGATTGGGG + Intronic
1128786182 15:70399322-70399344 ACTTGGGTGAAGGGTGGTGGGGG - Intergenic
1129365102 15:75049287-75049309 AAGTCGGTGAAGATGGATGTTGG + Exonic
1129753699 15:78083311-78083333 GGGTGGGTGAAGAAGGTTGGGGG + Intronic
1130175912 15:81570620-81570642 AGGTGGGGAAAGAAGGATGGAGG - Intergenic
1130324947 15:82872330-82872352 TCTGGGGTGATGAGGGATGGAGG - Intronic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1132463722 16:68127-68149 ACCTGGATGTAGAGGCATGGCGG - Intronic
1132789155 16:1675453-1675475 ATGTGGGGGAAGAGGAATGGTGG - Exonic
1133140628 16:3741151-3741173 CCCTGGGTGAGGAGGGGTGGCGG - Intronic
1134299622 16:12978020-12978042 AAGTGGGTGAATAAAGATGGGGG + Intronic
1134871667 16:17657508-17657530 ACGTGGATGAAGAGAGAAGCTGG + Intergenic
1135099642 16:19594799-19594821 GAGGGGGTGAAGAGGAATGGAGG + Intronic
1135108046 16:19668051-19668073 ATGTGTCTGAAGATGGATGGTGG - Intronic
1136768382 16:32811205-32811227 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1138261408 16:55625990-55626012 AAGTGGGTGAAGCAGGATGCTGG - Intergenic
1139588296 16:67918467-67918489 ACCTGGGTGACAAGGGCTGGTGG + Intronic
1140004945 16:71065398-71065420 AGGTGGGGGGAGAGGGAGGGAGG + Intronic
1141112631 16:81282645-81282667 TGGTGGGTGAGCAGGGATGGGGG - Intronic
1141309793 16:82902586-82902608 ACGTGAGAAAAGAGGGGTGGGGG - Intronic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141713919 16:85716298-85716320 AGGAGGGAGAAGAGGGAGGGAGG + Intronic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142112303 16:88339307-88339329 ACATGGTAGCAGAGGGATGGGGG + Intergenic
1142286640 16:89174137-89174159 ATGTGGAAGAAGAGGCATGGAGG - Intronic
1203070774 16_KI270728v1_random:1073221-1073243 ATGGGGGAGAAGAAGGATGGTGG - Intergenic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1143120350 17:4602803-4602825 AAGTGGGTGAAGAGCAAAGGTGG + Intronic
1143645248 17:8225713-8225735 CCGCTGGTGGAGAGGGATGGAGG + Intergenic
1148219032 17:45849459-45849481 GGGTTGGGGAAGAGGGATGGAGG - Intergenic
1148711934 17:49688299-49688321 ATGTGGGTGAAGGGGAATTGGGG + Intergenic
1148752498 17:49953283-49953305 AGGTGGTTTAAGAGGGATGCTGG + Intergenic
1148848502 17:50542511-50542533 GCCTGGGTGACGGGGGATGGAGG - Exonic
1149117991 17:53122198-53122220 ATGTGTGTGTAGAGGGGTGGGGG + Intergenic
1149570347 17:57667796-57667818 AGGTGGGTGAGGGAGGATGGTGG - Intronic
1151259813 17:72907689-72907711 ACCTGAGTGGAGTGGGATGGAGG - Intronic
1152036103 17:77874179-77874201 ATGTGGCTGGGGAGGGATGGGGG - Intergenic
1152067992 17:78121958-78121980 AGGTGGGTGGAGAGGGGTTGAGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1154136742 18:11786393-11786415 ACGTGGCTGAAGAAGCGTGGTGG + Intronic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1154424951 18:14264976-14264998 AGGCGGGTGAGGAGGGTTGGGGG + Intergenic
1156453089 18:37277587-37277609 AGCTGGGAGAAGAGGGCTGGGGG + Intronic
1156474581 18:37397548-37397570 CCATGGGTGGGGAGGGATGGAGG + Intronic
1156475321 18:37402297-37402319 ACATGGGAGAAGAGGCATTGGGG + Intronic
1156502595 18:37568908-37568930 AGGTGGGAGAAGGGGGAGGGTGG - Intergenic
1156628530 18:38939761-38939783 AGATGGGTGAAAAGAGATGGGGG - Intergenic
1157473489 18:48007478-48007500 ACGGGGGTCAAGAATGATGGGGG - Intergenic
1157961219 18:52155356-52155378 ACGTGGGTGGGGGGAGATGGAGG - Intergenic
1158376325 18:56873489-56873511 AGGTGGGGGACCAGGGATGGAGG + Intronic
1159190808 18:65039717-65039739 AAATGGGTGAAAAGGGATGGAGG - Intergenic
1159812966 18:73038990-73039012 CTCTGGGAGAAGAGGGATGGGGG - Intergenic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1163684050 19:18700617-18700639 ACCTGGGTGCAGAGGGTGGGTGG + Intronic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165070782 19:33253809-33253831 GAGTGCCTGAAGAGGGATGGCGG - Intergenic
1165386128 19:35511653-35511675 GCCTGGGTGGAGAGGGAGGGAGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166410402 19:42552728-42552750 GCCTGGGTGAAGAGGGCAGGAGG + Intronic
1166931945 19:46306383-46306405 AGGTGGGAGAAGAGGAATAGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167668466 19:50836471-50836493 ACGTGGAAGAACAGGGAAGGAGG - Intronic
1167706968 19:51086818-51086840 CCGAGGGTGATGGGGGATGGTGG + Intergenic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
1168153650 19:54461808-54461830 ACATGGCAGAAGAGGGAGGGAGG - Exonic
1168162537 19:54521139-54521161 ACGTGGGTGAGGAGGGACTCGGG + Intergenic
1168360102 19:55732359-55732381 ACCTGGGTCAAGAGGGTTTGAGG + Exonic
1168375356 19:55872953-55872975 ACTTGGGTGAAGAGTAATAGTGG + Intronic
925887094 2:8402362-8402384 ACCTGGGTGGAGAGGGCAGGTGG - Intergenic
927091856 2:19718557-19718579 ACGTGGAAGGAGAGTGATGGAGG - Intergenic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928255811 2:29721343-29721365 TAGTGGGAGAAGAGGGGTGGAGG + Intronic
930641365 2:53857443-53857465 AGAGGGGTGAAGAGGGATGCAGG + Intronic
931145567 2:59513002-59513024 AAGAGGGTGGAAAGGGATGGAGG + Intergenic
932223827 2:70023196-70023218 ATGTGGGAGAAGAAAGATGGGGG + Intergenic
933690066 2:85172856-85172878 AGAGGGGTGAAGAGGGCTGGAGG - Intronic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
935526188 2:104170777-104170799 TGGTGGGTGAAGAGGTTTGGGGG - Intergenic
935716742 2:105945925-105945947 GTGTGGGTGTAGGGGGATGGTGG + Intergenic
936531928 2:113282546-113282568 ACGTAGGGGAAGTGGCATGGTGG - Intergenic
936667285 2:114610902-114610924 GCGTGGGAGAAGGGGGGTGGTGG - Intronic
941356875 2:164504634-164504656 ATGAGGCTGAAGAGGGAAGGAGG - Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943521527 2:188957296-188957318 ACGTGGGTGAAGAAAGAGGGAGG - Intergenic
943761252 2:191611888-191611910 AAGTGTGTGCACAGGGATGGCGG + Intergenic
945641087 2:212430819-212430841 AGGTGGGAGATGGGGGATGGGGG + Intronic
945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG + Intergenic
946371213 2:219282602-219282624 AGGAGGGGGAAGAGGGATGGAGG - Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
947535779 2:230939842-230939864 CCCTGGGTGGGGAGGGATGGTGG - Intronic
948604791 2:239128093-239128115 GGTTGGGTGAAAAGGGATGGTGG - Intronic
948740288 2:240042110-240042132 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740303 2:240042166-240042188 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740332 2:240042278-240042300 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740340 2:240042306-240042328 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740376 2:240042446-240042468 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740384 2:240042474-240042496 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740392 2:240042502-240042524 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740400 2:240042530-240042552 CCGTGGGTGAAGAGGCATGGAGG + Exonic
948740408 2:240042558-240042580 CCGTGGGTGAAGAGGCATGGAGG + Exonic
1168761732 20:354220-354242 AGGTGGGTGAAGAAGGCTGGAGG + Exonic
1169088825 20:2844742-2844764 AGGTGCATGAAGTGGGATGGAGG + Intronic
1170273139 20:14550460-14550482 GCATGGCTGAAGAGGGAGGGAGG - Intronic
1171299258 20:24045417-24045439 AGGGGGGTGAAATGGGATGGTGG + Intergenic
1171345135 20:24460182-24460204 ACGTTGGTGGAGAGGGTTGCAGG - Intergenic
1172888312 20:38246440-38246462 ACGTGGAGGAATAGGGGTGGGGG + Intronic
1172931675 20:38591050-38591072 AGGTGGGGCAAGAGGGCTGGGGG - Intergenic
1174414662 20:50358854-50358876 GGGTGGGTGCAGAGGGCTGGTGG - Intergenic
1175183565 20:57165177-57165199 ACGTGGGCTGACAGGGATGGAGG - Intergenic
1175395100 20:58652104-58652126 ACGTGAATGCAGAGGGCTGGAGG - Exonic
1175468106 20:59206741-59206763 AGGTGGGGGATGAGGTATGGAGG + Intronic
1178389598 21:32187461-32187483 TCTTGGGTCCAGAGGGATGGGGG + Intergenic
1179516767 21:41913935-41913957 AAGTGGGTGAAGGGGGATGTAGG - Intronic
1179681299 21:43023067-43023089 ACGAGGGTGAGGAGGGACTGAGG - Intronic
1180207723 21:46272370-46272392 AGCTGGGGGAAGAGCGATGGGGG - Intronic
1180978558 22:19866864-19866886 ACGTATGTGAAGAATGATGGTGG + Intergenic
1181534068 22:23532821-23532843 AGATGGGGGAAGAGGGAGGGAGG + Intergenic
1182295581 22:29309806-29309828 AAGTGGGTGAAGCGGGAGTGAGG + Intronic
1183244800 22:36685495-36685517 AGGTGGGGGCAGAGCGATGGGGG - Intronic
1183548790 22:38469200-38469222 CCGGGGATGAAGAGGCATGGAGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
950152867 3:10701824-10701846 ATGTGTGTGAAGAGTGATAGAGG - Intronic
950431345 3:12952854-12952876 AGGTGGCAGAAGAGGGATGAGGG + Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951160944 3:19420981-19421003 ACGTGTGTTAAGAGAGAAGGAGG + Intronic
952040335 3:29253730-29253752 ACATGGGTTAAGATGGGTGGAGG + Intergenic
952323722 3:32301544-32301566 TGGTGGATGAAGAGGGATAGGGG + Intronic
952499953 3:33951864-33951886 ATGGGAGTGAAGAAGGATGGTGG + Intergenic
953336399 3:42098048-42098070 AAGTGGGTAAGGAGAGATGGAGG - Intronic
954073316 3:48158887-48158909 AAGAGGGTAAAGGGGGATGGAGG + Exonic
954872052 3:53774728-53774750 GCGTGGGTCCAGAGGGACGGAGG + Intronic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
959125541 3:102286164-102286186 ACTTCTGTGAAGAGAGATGGTGG + Intronic
961014284 3:123455490-123455512 ACGAGGGGGAAGATGGCTGGAGG - Intergenic
961565451 3:127760406-127760428 ACGTGGGTGCTGAGGAATGAAGG + Intronic
962502997 3:136014342-136014364 AGTTTTGTGAAGAGGGATGGTGG + Intronic
964899303 3:161638579-161638601 ATGTGGCTGGAGAGGGATGATGG + Intergenic
964997421 3:162901285-162901307 CCATGGGTTAAGATGGATGGTGG - Intergenic
965072963 3:163939827-163939849 AACCGGGTGAAGAAGGATGGAGG - Intergenic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
969612178 4:8233512-8233534 AGGTGAGTGATGAGGGATGCAGG + Exonic
969690458 4:8701443-8701465 ACTTGGGTGAGGAGAGAGGGAGG - Intergenic
970214754 4:13746877-13746899 GGGTGGCTGAAGTGGGATGGAGG + Intergenic
971013760 4:22466367-22466389 ACGTGGGTGAAGAGGGATGGAGG - Intronic
973207660 4:47578373-47578395 TTGTGGGTGATGAGAGATGGGGG - Intronic
974200374 4:58630768-58630790 ACCTCAGTGAAAAGGGATGGGGG + Intergenic
976177873 4:82373231-82373253 ACGTGTGTGATGGGGGAGGGGGG + Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
977940035 4:102847929-102847951 ACGTGGGTTAAGGGGCATGGTGG - Intronic
985902419 5:2806758-2806780 ACGTTGGTGATGAGGTGTGGAGG + Intergenic
986970042 5:13322763-13322785 ACCTAGGTGAAGGGGGCTGGTGG - Intergenic
989592147 5:43121590-43121612 GCGGGGGAGAAGAGGGAGGGCGG + Exonic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
992447952 5:76850733-76850755 AAGAGAGGGAAGAGGGATGGAGG + Intronic
996879597 5:128280676-128280698 AGGTGTGGGGAGAGGGATGGTGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998251228 5:140554445-140554467 AGGTGGGTTAGGAGGAATGGTGG - Intronic
998746462 5:145265434-145265456 AGTTGTGTGAAGAAGGATGGTGG - Intergenic
1000371412 5:160540089-160540111 GAGTGGCTGAAGTGGGATGGAGG + Intergenic
1005023679 6:21442148-21442170 ATATGGATGAAGAGGAATGGGGG - Intergenic
1006428678 6:33982178-33982200 TTGTGTGTGAAGGGGGATGGGGG + Intergenic
1007390168 6:41546310-41546332 AGGAGGGTGGAGAGGGAAGGAGG - Intergenic
1008354584 6:50537138-50537160 AGGTGGGGGAAGAGGGAGGGGGG - Intergenic
1008762903 6:54875662-54875684 ACGGAGGGGAAGAGGGAAGGTGG + Intronic
1011538303 6:88402339-88402361 ACATGGTTGAGGAGGAATGGAGG - Intergenic
1011888328 6:92125832-92125854 ACCAGGGTGAAGAGGGGAGGAGG - Intergenic
1012935916 6:105366928-105366950 TGGTGGGTGGAGAGGGGTGGGGG + Intronic
1016126569 6:140411284-140411306 ATGTGGCTGAAGAGTGAAGGAGG + Intergenic
1017040966 6:150308354-150308376 TCCTGGATGAAGGGGGATGGAGG - Intergenic
1018086095 6:160302449-160302471 ACTTGAGTTTAGAGGGATGGAGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019332956 7:469960-469982 GGGTGGGTGAAGAGGGAGGTGGG - Intergenic
1021482306 7:21131146-21131168 ACCTGGGTGCTGGGGGATGGAGG + Intergenic
1024030092 7:45453650-45453672 GAGGGGGTGAGGAGGGATGGAGG + Intergenic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1026166725 7:67916689-67916711 ACGTGGGGGTTGGGGGATGGGGG - Intergenic
1027162545 7:75813264-75813286 ACGTGGCAGGAGAGGGGTGGGGG - Intronic
1028143970 7:87301125-87301147 ACTTGAGTGTAGAGGGAAGGAGG + Intergenic
1029525235 7:101089794-101089816 AGGTGGGTGGAGGGGGATGCTGG + Exonic
1029745434 7:102513424-102513446 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1029763373 7:102612403-102612425 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1030138992 7:106285578-106285600 AGGAGGGACAAGAGGGATGGAGG - Intronic
1030236037 7:107263187-107263209 AAGTGGCTGAAGATGGGTGGAGG - Intronic
1031348650 7:120701021-120701043 TCGTGGGTGAAGTAGGATGCGGG + Intronic
1032390490 7:131552527-131552549 AGGTGGGGGAAGAGGCATGGAGG - Intronic
1035105885 7:156441200-156441222 AGGGGGGTGAAGAGCAATGGGGG - Intergenic
1035271521 7:157722684-157722706 ACAGGGGTGAGGAGGGAAGGAGG + Intronic
1036654904 8:10671751-10671773 ACGTGGCTGAAGGAGGATGACGG + Intronic
1038407582 8:27333631-27333653 ACAGAGGTGAAGAGGAATGGTGG - Intronic
1038951355 8:32417720-32417742 ACGGGGGTGGAGGGGGAGGGGGG + Intronic
1039099997 8:33930586-33930608 ACCTGGATGAAGAGGGAAGAAGG - Intergenic
1039920665 8:41892167-41892189 AGGTGGGGAAAGTGGGATGGAGG - Intronic
1043088247 8:75865077-75865099 ATGAGGGTCAGGAGGGATGGAGG - Intergenic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1046637773 8:116691342-116691364 ACCTGGGGGAAGAGGAGTGGGGG + Intronic
1048047681 8:130788479-130788501 ATGGGGGTGAAGAGGGACTGGGG + Intronic
1048223257 8:132562705-132562727 ATGTGGGTGATGGGGGGTGGGGG - Intergenic
1049587236 8:143437738-143437760 ACCTGGGTGGGGAGGGCTGGGGG + Exonic
1049757901 8:144318919-144318941 ACCTGGGGGTGGAGGGATGGGGG + Exonic
1050516932 9:6454557-6454579 ACGTAGGTGATGGGGGCTGGGGG - Intronic
1051061587 9:13051583-13051605 ATTTGGATGAAGAGGGAAGGAGG + Intergenic
1052354434 9:27489621-27489643 ATGTGGGTGATGGGGGTTGGAGG + Intronic
1052417218 9:28191548-28191570 AAGGGGGTTAAGAGGGAGGGAGG - Intronic
1053429222 9:38031003-38031025 ATGTGGGTGAAGACAGATGGCGG - Intronic
1053656556 9:40222791-40222813 AGGTAGCTGGAGAGGGATGGAGG - Intergenic
1053906908 9:42852009-42852031 AGGTAGCTGGAGAGGGATGGAGG - Intergenic
1054368660 9:64369013-64369035 AGGTAGCTGGAGAGGGATGGAGG - Intergenic
1054528059 9:66153494-66153516 AGGTAGCTGGAGAGGGATGGAGG + Intergenic
1054676288 9:67858765-67858787 AGGTAGCTGGAGAGGGATGGAGG - Intergenic
1055543356 9:77339063-77339085 AAATGGGTGATGAGGGATTGTGG + Intronic
1056143624 9:83707952-83707974 ACGTGGGGGAAGGGGCAGGGAGG - Exonic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1057495225 9:95555175-95555197 ATGTGTGTGAAAAGGTATGGAGG + Intergenic
1057499092 9:95582595-95582617 AAATGGGTGAGGGGGGATGGGGG + Intergenic
1058869359 9:109189123-109189145 ACGTGGGTGAGAAGGGAAGGAGG - Intronic
1058882677 9:109299091-109299113 AAGTGGGTTATGAGGAATGGAGG + Intronic
1061489660 9:130938243-130938265 ACGCGGGTGCAGAGGGAGGCGGG - Intronic
1061633755 9:131891848-131891870 AGAGGGGTGGAGAGGGATGGGGG + Intronic
1062204750 9:135329789-135329811 ACGTGGGTGCAGATGGTTTGGGG + Intergenic
1062315387 9:135964654-135964676 TCGTGGGTGAAGCGGGGTGGGGG - Intergenic
1185560264 X:1055550-1055572 ACGTGGGTGAAGAAGGAGTTTGG + Intergenic
1186334393 X:8570822-8570844 ACGGGGGTGGAGGGGCATGGTGG + Intronic
1187764865 X:22630363-22630385 AGGTGGGTGAAGAGGCAGGCGGG + Intergenic
1187905189 X:24059214-24059236 ACGTGTGTAAATAGGTATGGTGG + Intronic
1189283063 X:39832740-39832762 ACCTGGGTGGAAAGGAATGGAGG + Intergenic
1195696224 X:107669599-107669621 AGGAGGGGGAAGGGGGATGGGGG - Intergenic
1196438190 X:115693579-115693601 GCGTGGGGGAAGCAGGATGGAGG + Intergenic
1199420918 X:147643877-147643899 AAGAGAGTGAAGAGGGGTGGGGG - Intergenic