ID: 971018936 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:22515632-22515654 |
Sequence | AGCACGATGGGCGGCCCCGA GGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 431 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 5, 4: 424} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
971018936_971018944 | 1 | Left | 971018936 | 4:22515632-22515654 | CCCTCGGGGCCGCCCATCGTGCT | 0: 1 1: 1 2: 0 3: 5 4: 424 |
||
Right | 971018944 | 4:22515656-22515678 | GCAGCCGGCGGGCAGCGCCGCGG | 0: 1 1: 1 2: 4 3: 36 4: 284 |
||||
971018936_971018943 | -10 | Left | 971018936 | 4:22515632-22515654 | CCCTCGGGGCCGCCCATCGTGCT | 0: 1 1: 1 2: 0 3: 5 4: 424 |
||
Right | 971018943 | 4:22515645-22515667 | CCATCGTGCTTGCAGCCGGCGGG | 0: 1 1: 1 2: 0 3: 0 4: 52 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
971018936 | Original CRISPR | AGCACGATGGGCGGCCCCGA GGG (reversed) | Exonic | ||