ID: 971018936

View in Genome Browser
Species Human (GRCh38)
Location 4:22515632-22515654
Sequence AGCACGATGGGCGGCCCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971018936_971018944 1 Left 971018936 4:22515632-22515654 CCCTCGGGGCCGCCCATCGTGCT 0: 1
1: 1
2: 0
3: 5
4: 424
Right 971018944 4:22515656-22515678 GCAGCCGGCGGGCAGCGCCGCGG 0: 1
1: 1
2: 4
3: 36
4: 284
971018936_971018943 -10 Left 971018936 4:22515632-22515654 CCCTCGGGGCCGCCCATCGTGCT 0: 1
1: 1
2: 0
3: 5
4: 424
Right 971018943 4:22515645-22515667 CCATCGTGCTTGCAGCCGGCGGG 0: 1
1: 1
2: 0
3: 0
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971018936 Original CRISPR AGCACGATGGGCGGCCCCGA GGG (reversed) Exonic