ID: 971025454

View in Genome Browser
Species Human (GRCh38)
Location 4:22584851-22584873
Sequence TTCTTCTTGTAGACGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971025451_971025454 10 Left 971025451 4:22584818-22584840 CCCCTTTGTTAAGGATAGAATTC No data
Right 971025454 4:22584851-22584873 TTCTTCTTGTAGACGTCTGAAGG No data
971025453_971025454 8 Left 971025453 4:22584820-22584842 CCTTTGTTAAGGATAGAATTCAG No data
Right 971025454 4:22584851-22584873 TTCTTCTTGTAGACGTCTGAAGG No data
971025452_971025454 9 Left 971025452 4:22584819-22584841 CCCTTTGTTAAGGATAGAATTCA No data
Right 971025454 4:22584851-22584873 TTCTTCTTGTAGACGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971025454 Original CRISPR TTCTTCTTGTAGACGTCTGA AGG Intergenic
No off target data available for this crispr