ID: 971027297

View in Genome Browser
Species Human (GRCh38)
Location 4:22600759-22600781
Sequence AAGTTAATTTAGACGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971027294_971027297 -6 Left 971027294 4:22600742-22600764 CCACCTATACCAATTCTAAGTTA No data
Right 971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG No data
971027295_971027297 -9 Left 971027295 4:22600745-22600767 CCTATACCAATTCTAAGTTAATT No data
Right 971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG No data
971027293_971027297 14 Left 971027293 4:22600722-22600744 CCAGCAGAGAGTAAAAGAGGCCA No data
Right 971027297 4:22600759-22600781 AAGTTAATTTAGACGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971027297 Original CRISPR AAGTTAATTTAGACGAAACA AGG Intergenic
No off target data available for this crispr