ID: 971030600

View in Genome Browser
Species Human (GRCh38)
Location 4:22633643-22633665
Sequence GTGTGTGTGTATAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971030596_971030600 15 Left 971030596 4:22633605-22633627 CCTGTGACTGGTGTAGGTAGGAT No data
Right 971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971030600 Original CRISPR GTGTGTGTGTATAAAGTGGA AGG Intergenic
No off target data available for this crispr