ID: 971030935

View in Genome Browser
Species Human (GRCh38)
Location 4:22635892-22635914
Sequence GCTCACCTGACCCCTGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971030935_971030941 6 Left 971030935 4:22635892-22635914 CCGCCAGCAGGGGTCAGGTGAGC No data
Right 971030941 4:22635921-22635943 GGTGTGTGTGTAGCTCTGTGAGG No data
971030935_971030944 11 Left 971030935 4:22635892-22635914 CCGCCAGCAGGGGTCAGGTGAGC No data
Right 971030944 4:22635926-22635948 GTGTGTAGCTCTGTGAGGGAGGG No data
971030935_971030942 7 Left 971030935 4:22635892-22635914 CCGCCAGCAGGGGTCAGGTGAGC No data
Right 971030942 4:22635922-22635944 GTGTGTGTGTAGCTCTGTGAGGG No data
971030935_971030943 10 Left 971030935 4:22635892-22635914 CCGCCAGCAGGGGTCAGGTGAGC No data
Right 971030943 4:22635925-22635947 TGTGTGTAGCTCTGTGAGGGAGG No data
971030935_971030945 29 Left 971030935 4:22635892-22635914 CCGCCAGCAGGGGTCAGGTGAGC No data
Right 971030945 4:22635944-22635966 GAGGGAGCAACTTACCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971030935 Original CRISPR GCTCACCTGACCCCTGCTGG CGG (reversed) Intergenic
No off target data available for this crispr