ID: 971033893

View in Genome Browser
Species Human (GRCh38)
Location 4:22671603-22671625
Sequence TTGGTTGTACAGATTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971033890_971033893 10 Left 971033890 4:22671570-22671592 CCAAATATTAGACTCTTAACTAA No data
Right 971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971033893 Original CRISPR TTGGTTGTACAGATTGAGAA GGG Intergenic
No off target data available for this crispr