ID: 971039866

View in Genome Browser
Species Human (GRCh38)
Location 4:22740051-22740073
Sequence GGTTTCGGTTTCCTTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971039866_971039873 -5 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039873 4:22740069-22740091 AAACCACTGGAGAGTGGGGGTGG No data
971039866_971039872 -8 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039872 4:22740066-22740088 CCGAAACCACTGGAGAGTGGGGG No data
971039866_971039876 12 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data
971039866_971039870 -9 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039870 4:22740065-22740087 ACCGAAACCACTGGAGAGTGGGG No data
971039866_971039875 -2 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039875 4:22740072-22740094 CCACTGGAGAGTGGGGGTGGTGG No data
971039866_971039869 -10 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039869 4:22740064-22740086 AACCGAAACCACTGGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971039866 Original CRISPR GGTTTCGGTTTCCTTGCTCT TGG (reversed) Intergenic
No off target data available for this crispr