ID: 971039871

View in Genome Browser
Species Human (GRCh38)
Location 4:22740066-22740088
Sequence CCCCCACTCTCCAGTGGTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971039871_971039877 17 Left 971039871 4:22740066-22740088 CCGAAACCACTGGAGAGTGGGGG No data
Right 971039877 4:22740106-22740128 TGGAAACCACCTGAATATTGTGG No data
971039871_971039876 -3 Left 971039871 4:22740066-22740088 CCGAAACCACTGGAGAGTGGGGG No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971039871 Original CRISPR CCCCCACTCTCCAGTGGTTT CGG (reversed) Intergenic
No off target data available for this crispr