ID: 971039874

View in Genome Browser
Species Human (GRCh38)
Location 4:22740072-22740094
Sequence CCACCACCCCCACTCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971039874_971039876 -9 Left 971039874 4:22740072-22740094 CCACTGGAGAGTGGGGGTGGTGG No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data
971039874_971039877 11 Left 971039874 4:22740072-22740094 CCACTGGAGAGTGGGGGTGGTGG No data
Right 971039877 4:22740106-22740128 TGGAAACCACCTGAATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971039874 Original CRISPR CCACCACCCCCACTCTCCAG TGG (reversed) Intergenic