ID: 971039875

View in Genome Browser
Species Human (GRCh38)
Location 4:22740072-22740094
Sequence CCACTGGAGAGTGGGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971039866_971039875 -2 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039875 4:22740072-22740094 CCACTGGAGAGTGGGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971039875 Original CRISPR CCACTGGAGAGTGGGGGTGG TGG Intergenic