ID: 971039876

View in Genome Browser
Species Human (GRCh38)
Location 4:22740086-22740108
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971039871_971039876 -3 Left 971039871 4:22740066-22740088 CCGAAACCACTGGAGAGTGGGGG No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data
971039874_971039876 -9 Left 971039874 4:22740072-22740094 CCACTGGAGAGTGGGGGTGGTGG No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data
971039866_971039876 12 Left 971039866 4:22740051-22740073 CCAAGAGCAAGGAAACCGAAACC No data
Right 971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type