ID: 971040101

View in Genome Browser
Species Human (GRCh38)
Location 4:22742377-22742399
Sequence TCATATACAAAGGTGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971040101_971040107 -8 Left 971040101 4:22742377-22742399 CCCAGTGCCACCTTTGTATATGA No data
Right 971040107 4:22742392-22742414 GTATATGAGTTCATCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971040101 Original CRISPR TCATATACAAAGGTGGCACT GGG (reversed) Intergenic
No off target data available for this crispr