ID: 971047505

View in Genome Browser
Species Human (GRCh38)
Location 4:22821659-22821681
Sequence GCAACCTTGGTATTTGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971047502_971047505 -5 Left 971047502 4:22821641-22821663 CCATAAACTCAGAAGCTGGCAAC No data
Right 971047505 4:22821659-22821681 GCAACCTTGGTATTTGGCAGTGG No data
971047501_971047505 -4 Left 971047501 4:22821640-22821662 CCCATAAACTCAGAAGCTGGCAA No data
Right 971047505 4:22821659-22821681 GCAACCTTGGTATTTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971047505 Original CRISPR GCAACCTTGGTATTTGGCAG TGG Intergenic
No off target data available for this crispr